Probe, probe set, probe-immobilized carrier, and genetic testing method
AssigneeCanon Kabushiki Kaisha
InventorsToshifumi Fukui, Hideto Kuribayashi
Life of this patent
Estimating the term…
Abstract
A nucleic acid probe for classification of pathogenic bacterial species is capable of collectively detecting bacterial strains of the same species and differentially detecting them from other bacterial species. Any one of the base sequences of SEQ ID NOS. 49 to 51 or a combination of at least two of them is used for detecting the gene of an infectious disease pathogenic bacterium.
Claims13
A probe set for detecting a gene of infectious disease pathogenic bacterium, Eggerthella lenta, comprising three probes consisting of the following base sequences (1) to (3) respectively:
- (1) GGAAAGCCCAGACGGCAAGGGA (SEQ ID NO. 49) or the complementary sequence thereof;
- (2) CCTCTCAAGCGGGATCTCTAATCCGA (SEQ ID NO. 50) or the complementary sequence thereof;
- and
- (3) TGCCCCATGTTGCCAGCATTAGG (SEQ ID NO. 51) or the complementary sequence thereof.
A probe set for detecting a gene of infectious disease pathogenic bacterium, Eggerthella lenta, comprising the following three probes (A) to (C), wherein the probe set does not comprise any other probes to detect the gene of Eggerthella lenta:
- (A) a probe consisting of a base sequence of
- GGAAAGCCCAGACGGCAAGGGA;
- (SEQ ID NO. 49)
- (B) a probe consisting of a base sequence of
- CCTCTCAAGCGGGATCTCTAATCCGA;
- and
- (SEQ ID NO. 50)
- (C) a probe consisting of a base sequence of
- TGCCCCATGTTGCCAGCATTAGG.
- (SEQ ID NO. 51)
Dependencies are inferred from the claim text.