Back to results
US 7,612,195 B2Granted
Retroviral vectors for delivery of interfering RNA
AssigneeAventis Pharmaceuticals Inc.
InventorsDorre Grueneberg, Gerard Bain, Nayantara Kothari
Life of this patent
Estimating the term…
Abstract
Provided herein are retroviral vectors for delivering interfering RNA into cells.
Claims10
A retroviral vector for carrying a target gene specific insert into a cell in order to modify the expression of a target gene having a sense strand and an antisense strand, comprising:
- (a) a U6 promoter having a sequence of:
- (SEQ ID NO:7)
- ttcccatgattccttcatatttgcatatacgatacaaggctgttagagag
- ataattagaattaatttgactgtaaacacaaagatattagtacaaaatac
- gtgacgtagaaagtaataatttcttgggtagtttgcagtttttaaaatta
- tgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcga
- tttcttgcctttatatatcttgtggaaaggacgaaacaccg;
- and
- (b) a polylinker region comprising a nucleotide sequence of gatcc gctgggactcctttgcatg ttcaagaga catgcaaaggagtcccagc ttttt ggaa a (SEQ ID NO:4)
- (c) a target gene specific insert comprising double stranded RNA, wherein said double stranded RNA comprises a sense portion that is complementary to a portion of the antisense strand of the target gene, and an antisense portion that is complementary to the sense portion, so that the sense portion and antisense portion anneal, and the double stranded RNA folds back upon itself.
7 more elements
A modified Lentivirus vector for carrying double stranded RNA into a cell in order to modify the expression of a target gene having a sense strand and an antisense strand, wherein:
- (a) the endogenous CMV promoter of the Lentivirus has been removed, said modified Lentivirus vector comprising:
- (i) a REV element that binds to a REV response element (RRE) is inserted;
- (ii) a U6 promoter sequence of
- (SEQ ID NO:7)
- ttcccatgattccttcatatttgcatatacgatacaaggctgttagagag
- ataattagaattaatttgactgtaaacacaaagatattagtacaaaatac
- gtgacgtagaaagtaataatttcttgggtagtttgcagtttttaaaatta
- tgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcga
- tttcttgcctttatatatcttgtggaaaggacgaaacaccg;
- and
- (b) a polylinker region comprising a nucleotide sequence of:
- gatcc gctgggactcctttgcatg ttcaagaga catgcaaaggagtcccagc ttttt ggaa a (SEQ ID NO:4);
- wherein said double stranded RNA comprises a sense portion that is complementary to a portion of the antisense strand of the target gene, and an antisense portion that is complementary to the sense portion so that the sense portion and antisense portion anneal, and the double stranded RNA folds back upon itself.
10 more elements
A modified lentivirus pLenti-U6-Blasti, comprising the nucleotide sequence of SEQ ID NO:8.
Dependencies are inferred from the claim text.