Identification and expression of a novel kinesin motor protein
AssigneeThe Regents of the University of California
InventorsRoman Sakowicz, Lawrence S. B. Goldstein
Life of this patent
Estimating the term…
Abstract
The invention provides isolated nucleic acid and amino acid sequences of TL-γ, antibodies to TL-γ, methods of screening for TL-γ modulators using biologically active TL-γ, and kits for screening for TL-γ modulators.
Claims24
An isolated nucleic acid sequence encoding a Thermomyces lanuginosus-γ, (TL-γ) protein comprising amino acids 1 to 357 of SEQ ID NO:1.
An isolated (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.
An isolated nucleic acid sequence comprising nucleotide sequence of SEQ ID NO:2.
An isolated (TL-γ) nucleic acid sequence encoding a protein comprising amino acids 1 to 357 of SEQ ID NO:1, said isolated nucleic acid sequence comprising sequence 5′ GATATTTCCACCGCCCGACAT 3′ (SEQ ID NO:8) that is complementary to 5′ ATGTCGGGCOGTGGAAATATC 3′ (SEQ ID NO:3), or comprising sequence 5′ TGAAAACAGCGAAGCAGGAATTC 3′ (SEQ ID NO:9) that is complementary to 5′ GAATTCCTGCTTCGCTGTTTTCA 3′ (SEQ ID NO:4), wherein said isolated nucleic acid sequence encodes a protein having plus end-directed microtubule motor activity.
An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1-1071 of SEQ ID NO:2.
An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1327-1803 of SEQ ID NO:2.
An isolated (TL-γ) nucleic acid sequence comprising nucleotides 1804-2352 of SEQ ID NO:2.
An isolated nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.
An expression vector comprising a (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.
A host cell transfected with an expression vector comprising a (TL-γ) nucleic acid sequence encoding SEQ ID NO:1.
An expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 602 to 784 of SEQ ID NO:1, wherein the protein has plus end-directed microtubule motor activity, and wherein the protein specifically binds to polyclonal antibodies to SEQ ID NO:1.
A host cell transfected with an expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 602 to 784 of SEQ ID NO:1, wherein the protein has plus end-directed microtubule motor activity, and wherein the protein specifically binds to polyclonal antibodies to SEQ ID NO:1.
An expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.
A host cell transfected with an expression vector comprising a nucleic acid sequence encoding a (TL-γ) protein comprising amino acids 358 to 442 of SEQ ID NO:1.
Dependencies are inferred from the claim text.