Mutant AOX2 promoter, vector carrying same, transformant and production of heterologous protein

Abstract

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Dependencies are inferred from the claim text.