Compositions and Methods for Treating a Neurologic Disease Using Dopaminergic Neurons with Enhanced Anti-inflammatory Activity
AssigneeKenai Therapeutics, Inc.
InventorHoward Federoff
Life of this patent
Estimating the term…
Abstract
A method of generating a population of cells useful for treating a brain disorder in a subject is disclosed. This disclosure provides compositions and methods to modify miR-155 in pluripotent cells, to differentiate the engineered pluripotent cells to disproportionately yield 155-3p or 155-5p in DA neurons and engraft the miR-155-3p or miR-155-5p biased DA neuron progenitors, astrocytic progenitors and/or leptomeningeal progenitors in a human subject to produce an anti-inflammatory effect.
Claims31
A DA neuronal cell in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased compared to wildtype or native unmodified cells.
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
(canceled)
The DA neuronal cell of claim 1, The DA neuronal cell of claim 27, wherein the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased compared to wildtype differentiated cell populations.
A DA neuronal cell in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased compared to wildtype DA neuronal cells and wherein the endogenous genomic sequence encoding miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof is deleted or mutated in said DA neuronal cells.
A DA neuronal cell in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased compared to wildtype DA neuronal cells and compared to miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof.
Dependencies are inferred from the claim text.