Compositions and methods for treating hemoglobinopathies
AssigneeBeam Therapeutics Inc.
InventorsIan Slaymaker, Nicole Gaudelli, Yi Yu, Bernd Zetsche, David A. Born, Seung-Joo Lee, Michael Packer
Life of this patent
Estimating the term…
Abstract
The present invention features compositions and methods for editing deleterious mutations associated with hemoglobinopathies, such as sickle cell disease (SCD). In particular embodiments, the invention provides methods for correcting mutations in a beta globin polynucleotide using modified adenosine base editors termed “ABE8” having unprecedented levels (e.g., >60-70%) of efficiency.
Claims30
A base editor system comprising a guide RNA comprising the nucleic acid sequence of SEQ ID NO:
- 151 and a base editor comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, wherein the adenosine deaminase domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO:
- 2, and wherein the adenosine deaminase domain comprises the alterations Y147R, Q154R, and Y123H referenced to SEQ ID NO:
- 2, or a polynucleotide encoding the base editor.
A base editor system comprising a guide RNA comprising the following nucleic acid sequence:
- (SEQ ID NO:
- 176)
- mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
- UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
- GCUsmUsmUsmU,
- wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and a base editor comprising an amino acid sequence with at least 95% identity to SEQ ID NO:
- 107, or a polynucleotide encoding the base editor.
A base editor system comprising a guide RNA comprising the following nucleic acid sequence:
- (SEQ ID NO:
- 176)
- mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
- UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
- GCUsmUsmUsmU,
- wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and an mRNA encoding a base editor comprising the amino acid sequence of SEQ ID NO:
- 107.
A pharmaceutical composition comprising a base editor system comprising a guide RNA comprising the following nucleic acid sequence:
- (SEQ ID NO:
- 176)
- mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
- UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
- GCUsmUsmUsmU,
- wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and mRNA encoding a base editor comprising the amino acid sequence of SEQ ID NO:
- 107, and a pharmaceutically acceptable carrier, vehicle, or excipient.
Dependencies are inferred from the claim text.