Intron fragments

A polynucleotide comprising (i) a transgene and (ii) a control element operably linked to the transgene, wherein the control element comprises (from 5′ to 3′):

• 1) the CMV enhancer set forth in SEQ ID NO:
• 4;
• 2) a promoter selected from the CMV promoter sequence set forth in SEQ ID NO:
• 5 or 6, the EF-1α promoter sequence set forth in SEQ ID NO:
• 7, or the chicken β-actin promoter sequence set forth in SEQ ID NO:
• 8;
• 3) an exon 1 (E1) sequence selected from the CMV E1 sequence set forth in SEQ ID NO:
• 12, the EF-1α E1 sequence set forth in SEQ ID NO:
• 13, or the chicken β-actin E1 sequence set forth in SEQ ID NO:
• 14 or 15;
• 4) the splicing donor sequence set forth in SEQ ID NO:
• 9 or 10;
• 5) a single fragment of the EF-1α intron A sequence set forth in SEQ ID NO:
• 1 (“EF-1α intron fragment”), wherein the EF-1α intron fragment consists of the nucleotide sequence set forth in SEQ ID NO:
• 2;
• SEQ ID NO:
• 3
• (TGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCA
• TTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAG)
• or
• (CCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGT
• TCAAAGTTTTTTTCTTCCATTTCAG)
• and
• 6) the EF-1α E2 sequence set forth in SEQ ID NO:
• 11.

A method of treating an ophthalmic disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus particle and a pharmaceutically acceptable carrier, wherein the recombinant adeno-associated virus particle comprises (a) an AAV type 8 capsid protein and (b) a polynucleotide comprising (i) a transgene, which comprises the nucleotide sequence set forth in SEQ ID NO:

• 23, and (ii) a control element operably linked to the transgene, wherein the control element comprises (from 5′ to 3′):
• 1) the cytomegalovirus (CMV) enhancer sequence set forth in SEQ ID NO:
• 4,
• 2) the chicken β-actin promoter sequence set forth in SEQ ID NO:
• 8,
• 3) the chicken β-actin exon 1 (E1) sequence set forth in SEQ ID NO:
• 15,
• 4) the splicing donor sequence of the chicken β-actin intron set forth in SEQ ID NO:
• 10,
• 5) a single fragment of the EF-1α intron A sequence set forth in SEQ ID NO:
• 1 (“EF-1α intron fragment”), wherein the EF-1α intron fragment consists of the nucleotide sequence set forth in SEQ ID NO:
• 2,
• SEQ ID NO:
• 3
• (TGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTT
• CATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTC
• AG)
• or
• (CCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTG
• GTTCAAAGTTTTTTTCTTCCATTTCAG)
• and
• 6) the EF-1a exon 2 (E2) sequence set forth in SEQ ID NO:
• 11.