Dosing of muscle targeting complexes for treating dystrophinopathies

A method of promoting expression or activity of a dystrophin protein or treating Duchenne Muscular Dystrophy (DMD) in a subject, comprising administering to the subject a composition comprising an effective amount of complexes, each complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 1 mg to 90 mg of the anti-TfR1 antibody of the complexes per kg of the subject, wherein the antibody comprises:

• a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs:
• 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs:
• 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs:
• 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs:
• 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs:
• 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NOs:
• 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO:
• 21) and is a phosphorodiamidate morpholino oligomer (PMO).