Precise template-free correction of brca1 mutation in human cells via genome editing
OwnerChengzu Long, Orrin Devinsky +1inventors
InventorsChengzu Long, Orrin Devinsky, Gabriella Rudy
Life of this patent
Estimating the term…
Abstract
Provided are compositions and methods used for precise template-free correction of BRCA1 mutation in human cells via genome editing. The method involves modifying DNA that includes a BRCA1-5382-InsC mutation by introducing into cells comprising the BRCA1-5382-InsC a Cas enzyme and a guide RNA. A guide RNA that produces improved results relative to other guide RNAs is provided. Also provided are modified stem cells that contain an introduced BRCA1-5382-InsC mutation.
Claims15
A method for modifying DNA comprising a BRCA1-5382-InsC mutation, the method comprising introducing into cells comprising the BRCA1-5382-InsC a Cas enzyme and a guide RNA, said method being DNA template free, and said guide RNA being functional with an AGG protospacer adjacent motif (PAM) that is proximal to the BRCA1-5382-InsC mutation, and wherein the BRCA1-5382-InsC mutation is eliminated after introduction of the Cas enzyme and the guide RNA.
The method of 5, wherein the cells are present in an individual.
An expression vector encoding a guide RNA comprising the sequence AAGCGAGCAAGAGAAUCCCC (SEQ ID NO:
- 1), wherein the expression vector further encodes a Cas nuclease, said Cas nuclease optionally being Cas9.
Modified stem cells comprising an introduced BRCA1-5382-InsC mutation.
The stem cells of claim 15, wherein the stem cells are present in an in vitro cell culture.
Dependencies are inferred from the claim text.