Loading patent…
AssigneesWashington University, Wisconsin Alumni Research Foundation
InventorsJianghui Hou, Dale Bjorling, Zun-Yi Wang
Estimating the term…
A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
A composition for the treatment of bladder fibrosis in a patient in need, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence:
A method of preventing, reducing, or reversing bladder fibrosis in a patient in need, the method comprising administering an effective amount of a composition, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence:
Dependencies are inferred from the claim text.