A primer for next generation sequencer and a method for producing the same, a dna library obtained through the use of a primer for next generation sequencer and a method for producing the same, and a dna analyzing method using a dna library

A method for producing a primer comprising a nucleotide sequence of 5′-CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO:

• 1)-N5 to 15 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:
• 2)-3′, wherein N5 to 15 represents an index sequence of 5 to 15 nucleotides, the method comprising:
• (i) calculating, for the primer a putative number of reads based on a nucleotide sequence of the index sequence in accordance with an estimation formula that designates the putative number of reads as a purpose variable and a type of a nucleotide in the index sequence as an explanatory variable, to design a nucleotide sequence as a nucleotide sequence of the index sequence where the putative number of reads calculated exceeds a given level;
• and
• (ii) synthesizing a nucleotide sequence comprising the nucleotide sequence designed in (i).