Back to results
US 2020/0399712 A1Published application
Compositions and methods for the diagnosis and detection of tumors and cancer prognosis
OwnerJoseph Califanoinventor
Life of this patent
Estimating the term…
Abstract
Provided herein are probe and primer pairs that are useful for the detection of HPV in samples isolated from patients.
Claims20
A method for treating an HPV-related cancer in a patient, the patient having been selected for the treatment by detection of one or more of HPV E2, E4 or E5 in a sample isolated from the patient, the method comprising administering an effective amount of one or more of:
- FGFR inhibitor AZD4547, radiotherapy, or cisplatin optionally with cetuximab, thereby treating the patient.
A probe and primer pair, comprising:
- a) a forward primer comprising the sequence:
- GCACAATTGGCAGACACTAAT, or an equivalent thereof,
- a reverse primer comprising the sequence:
- GCACAATCCTTTACAATTTTTGCC, or an equivalent thereof, and
- a probe comprising the sequence:
- AGTAATGCAAGTGCCTTTCTAAAAAGTAATTC, or an equivalent thereof, or
- b) a forward primer comprising the sequence:
- GCAAAACGCACAAAACGTGC, or an equivalent thereof,
- a reverse primer comprising the sequence:
- GACATGTACCTGCCTGTTTGC, or an equivalent thereof, and
- a probe comprising the sequence:
- CGGCTACCCAACTTTATAAAACA, or an equivalent thereof.
9 more elements
Dependencies are inferred from the claim text.