Compositions and methods for modulating expression of nucleic acids

A synthetic miRNA precursor molecule comprising the following structure 5′ to 3′:

• A-B-C-D-E-F, wherein
• A is a nucleotide sequence that is optionally present and when present comprises a first strand and a second strand each of which independently comprise 1 to 50 nucleotides;
• B is a nucleotide sequence comprising a first strand (B′) and a second strand (B″), wherein the first strand comprises a miRNA passenger strand having a nucleotide sequence of GNGN15-22 (SEQ ID NO:1) and the second strand comprises a miRNA guide strand having the nucleotide sequence of UN16-23C (SEQ ID NO:2) and the passenger strand and the guide strand form a double stranded sequence having three mismatches;
• C is a nucleotide sequence comprising a first strand (C′) and a second strand (C″), wherein the first strand comprises a nucleotide sequence of GA[A/G][G/C]GGGCCUACGGACGGUGUUGU (SEQ ID NO:3), and the second strand comprises a nucleotide sequence of ACCACACCGUCCGGGCCC[G/C][C/A]UC (SEQ ID NO:4), and the first strand and second strand form a double stranded sequence comprising two to four mismatches or bulges, or any combination thereof;
• D is a nucleotide sequence comprising a first strand (D′) and a second strand (D″), wherein the first strand comprises a nucleotide sequence of UCCGCUGC[U/C]CGUUCAUG (SEQ ID NO:5), and the second strand comprises a nucleotide sequence of CAUGACCG[A/G]GGAGCUGC (SEQ ID NO:6) and the first strand and second strand form a double stranded sequence comprising two to four mismatches;
• E is a nucleotide sequence comprising a first strand (E′) and a second strand (E″), wherein the first strand comprises a nucleotide sequence of GUUCCC[C/A][A/C]UAUCUACUUCCA (SEQ ID NO:7), and the second strand comprises a nucleotide sequence of UGGAAGUAGCUU[U/G][G/U]GGUUUG (SEQ ID NO:8) and the first strand and second strand form a double stranded sequence comprising two mismatches;
• and
• F is a sequence comprising a length of 10 to 50 nucleotides and forming a loop.