Screening method for the detection of clostridium difficile
AssigneeUniversity College Cardiff Consultants Limited
InventorsLesley William James Baillie, Lovleen Tina Joshi
Life of this patent
Estimating the term…
Abstract
The invention concerns a screening method for the detection of Clostridium difficile in a sample, wherein said method comprises the detection of conserved target regions in the Clostridium genome through the binding of at least one oligonucleotide probe to said target site.
Claims36
A diagnostic method for the detection of C. difficile in a sample wherein said C. difficile comprises a nucleic acid target region having the following sequence:
- I)
- (SEQ ID NO:
- 1)
- Tcaagactctattatagtaagtgcaaatcaatatgaagt;
- which method comprises exposing said sample to at least one oligonucleotide probe selected from the group consisting of:
- a) an oligonucleotide probe that is complementary to at least a part of said target region;
- b) an oligonucleotide probe that is complementary to at least a part of a degenerate version of said target regions;
- and
- c) an oligonucleotide probe that is at least 80% homologous to the oligonucleotides in a) or b);
- and
- detecting the binding of said at least one oligonucleotide probe to said target region and, where binding occurs, concluding that C. difficile is present in said sample.
(canceled)
A kit for the detection of C. difficile in a sample wherein said C. difficile comprises a nucleic acid target region having the following sequence:
- I)
- (SEQ ID NO:
- 1)
- tcaagactctattatagtaagtgcaaatcaatatgaagt;
- which kit comprises:
- a) at least one oligonucleotide probe that is complementary to at least a part of said target region;
- or
- b) at least one oligonucleotide probe that is complementary to at least a part of a degenerate version of said target region or;
- c) an oligonucleotide probe that is at least 80% homologous to the oligonucleotides in a) or b);
- and
- optionally, reagents and/or instructions for practising said detection.
32-33. (canceled)
Dependencies are inferred from the claim text.