Back to results
US 2015/0104440 A1Published application
MiRNA-31 AS A DIAGNOSTIC, PROGNOSTIC AND THERAPEUTIC AGENT IN CANCER
AssigneeCornell University
InventorsPei-Chun Lin, Mark A. Rubin
Life of this patent
Estimating the term…
Loading patent…
Loading patent…
AssigneeCornell University
InventorsPei-Chun Lin, Mark A. Rubin
Estimating the term…
The current disclosure reveals a complex regulatory pattern between miR-31 and AR, indicating that miR-31 plays a key role in prostate cancer development and progression. Another aspect of the current disclosure shows that miR-31 directly targets and destabilizes AR mRNA through interaction with the AR mRNA coding sequence showing that miR-31, or a fragment thereof has the ability to act as a novel therapeutic agent in treating cancer. The current disclosure also shows that AR indirectly represses miR-31 expression by binding to the miR-31 promoter region and modulating methyltransferase activity. Another aspect of the current disclosure shows that miR-31 indirectly modulates AR activity by modulating regulators of cell cycle progression. The disclosure further provides an isolated nucleic acid that modulates the activity of the androgen receptor in a cell. The disclosure further provides a method of treating a prostate cancer in a subject, by administering to the subject an effective amount of an agent that modulates the activity or levels of miR-31.
A method of diagnosing prostate cancer in a subject comprising
A method of diagnosing prostate cancer in a subject comprising
A method of determining whether a subject is a candidate for treatment of prostate cancer with an AR targeting therapeutic agent comprising
15-17. (canceled)
A method of treating prostate cancer in a subject, comprising administering to the subject an effective amount of an agent that modulates the activity of miR-31.
19-37. (canceled)
An isolated nucleic acid used for modulating the activity of AR in a cell that is identical to or substantially identical to the nucleotide sequence UCGAUACGGUCGUAGAACGGA [SEQ ID NO:1].
Dependencies are inferred from the claim text.