Modulation of microrna-138 for the treatment of bone loss
AssigneeSyddansk Universitet
InventorsMoustapha Kassem, Basem Abdallah, Hanna Taipaleenmaeki, Sakari Kauppinen, Tilde Eskildsen, Jan Stenvang
Life of this patent
Estimating the term…
Abstract
There is provided nucleic acids (mir-138 Antimirs) for use in treating or preventing bone loss in a patient. Also there is provided a method for reducing the levels of endogenous mir-138 in a cell.
Claims12
Nucleic acid (Antimir) for use in treating or preventing bone loss in a patient, said antimir capable of hybridizing to a mir-138 (AGCUGGUGUUGUGAAUCAGGCCG).
A method for reducing the levels of endogenous mir-138 in a cell, said method comprising the introduction of the nucleic acid and/or the vector according to the present invention into a cell in an amount sufficient to reduce the levels of said mir-138.
A method for treating or preventing bone loss in a patient comprising the steps of providing one or more nucleic acids (Antimir) capable of hybridizing to a mir-138, and administering said one or more nucleic acids to the patient.
Dependencies are inferred from the claim text.