ARID1A and PPP2R1A Mutations in Cancer

A method of detecting cancer cells, comprising:

• (a) testing a biological sample of an individual to detect a mutation in an ARID1A gene;
• and
• (b) identifying the biological sample as containing cancer cells if the ARID1A gene comprises the mutation,
• wherein the cancer cells are from a cancer selected from the group consisting of adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchioalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor or
• (c) testing a biological sample of an individual to detect a mutation in an ARID1A gene;
• and
• (d) identifying the biological sample as containing cancer cells if the ARID1A gene comprises the mutation,
• wherein the cancer cells are from a cancer selected from the group consisting of adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchioalveolar carcinoma, Burkitt lymphoma, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, medulloepithelioma, melanoma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor;
• or
• (e) testing a biological sample of an individual to detect a mutation in an ARID1A gene;
• and
• (f) identifying the biological sample as containing cancer cells if the ARID1A gene comprises the mutation, wherein the mutation is selected from the group consisting of 3854—3855insA, 553C>T, 903—904dupGT, 3659—3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7), 585C>A, 3391delC, 4001—4002dupGCA, 6828—6829delTG, 1455—1466insCCTAC, 4926—4927insTGGC, 4011—4012delTT, 4635G>A, 5202T>A, 486—492delCGCCGCC, 3575delA, 3223delG, 6718dupG, 898—899insCGTC, 6710—6711insT, 1663C>T, 782—791delCGTCGTCTTC (SEQ ID NO:8), 3634—3644delCAGCCCAGTAT (SEQ ID NO:9), 1873C>T, 2122C>T, 1804G>T, 6702delT, 1341T>G, 3442delC, 883dupC, 2868delC, 1881delT;
• 2179—2188delCGGCCACCCA (SEQ ID NO:10), 4635G>A, 608dupA, 1626—1627delGC, 3994C>T, 6791C>G, 6625delC, 289G>T, 1650dupC, 2272delC, 1323delC, 6259G>A, 5719A>T, 2830C>T, 1014delG, 4689delC, 3281delA, 3344delC, 5548delG, 4354delC, 5548delG, 5548delG, 5548dupG, 1848delC, 2944—2946delAAC, 1657C>T, 6228C>A, 5838—5844dupACAGAGC, 5834—5835insAGCACAG, 2467—2468dupTA, 879dupC, 827delG, 4743—4744delCA, 5548delG, 4972C>T, 5359G>T, 5548delG, 4524T>A, 5548delG, 6420delC, 2357dupG, 854delG, 969—975delGGGCGCC, 2834delG, 6403—6408delATTCTG, 1015delG, 4893—4894InsC, 5012delG, IVS10+1G>A, 1945—1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, 2402delG, 3977delC, 5548dupG, and 3999—4101delGCA, wherein nucleotides are numbered by reference to SEQ ID NO:2;
• or
• (g) testing a biological sample of an individual to detect a mutation in an ARID1A gene;
• and
• (h) identifying the biological sample as containing cancer cells if the ARID1A gene comprises the mutation,
• wherein the mutation is selected from the group consisting of 3854—3855insA, 553C>T, 903—904dupGT, 3659—3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7), 585C>A, 3391delC, 4001—4002dupGCA, 6828—6829delTG, 1455—1466insCCTAC, 4926—4927insTGGC, 4011—4012delTT, 4635G>A, 5202T>A, 486—492delCGCCGCC, 3575delA, 3223delG, 6718dupG, 898—899insCGTC, 6710—6711insT, 1663C>T, 782—791delCGTCGTCTTC (SEQ ID NO:8), 3634—3644delCAGCCCAGTAT (SEQ ID NO:9), 1873C>T, 2122C>T, 1804G>T, 6702delT, 1341T>G, 3442delC, 883dupC, 2868delC, 1881delT;
• 2179—2188delCGGCCACCCA (SEQ ID NO:
• 10), 1323delC, 6259G>A, 5719A>T, 2830C>T, 1014delG, 4689delC, 3281delA, 3344delC, 5548delG, 4354delC, 5548delG, 5548delG, 5548dupG, 1848delC, 2944—2946delAAC, 1657C>T, 6228C>A, 5838—5844dupACAGAGC, 5834—5835insAGCACAG, 2467—2468dupTA, 879dupC, 827delG, 4743—4744delCA, 5548delG, 4972C>T, 5359G>T, 5548delG, 4524T>A, 5548delG, 6420delC, 2357dupG, 854delG, 969—975delGGGCGCC, 2834delG, 6403—6408delATTCTG, 4893—4894InsC, 5012delG, IVS10+1G>A, 1945—1946insT, 2296dupC, 5965C>T, 5965C>T, 6287C>G, 1585C>T, 5548dupG, 2402delG, 3977delC, 5548dupG, and 3999—4101delGCA,
• wherein nucleotides are numbered by reference to SEQ ID NO:2;
• or
• (i) testing a biological sample of an individual to detect a mutation in an PPP2R1A gene;
• and
• (j) identifying the biological sample as containing cancer cells if the PPP2R1A gene comprises the mutation,
• wherein the cancer cells are from a cancer selected from the group consisting of acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, anal cancer, appendix cancer, grade I (anaplastic) astrocytoma, grade II astrocytoma, grade III astrocytoma, grade IV astrocytoma, atypical teratoid/rhabdoid tumor of the central nervous system, basal cell carcinoma, bladder cancer, bronchial cancer, bronchioalveolar carcinoma, Burkitt lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endometrial cancer, endometrial uterine cancer, ependymoblastoma, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, fibrous histiocytoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gestational trophoblastic tumor, gestational trophoblastic tumor, glioma hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, Hilar cholangiocarcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, islet cell tumor, Kaposi sarcoma, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, macroglobulinemia, malignant fibrous histiocytoma medulloblastoma, medulloepithelioma, Merkel cell carcinoma, mesothelioma, endocrine neoplasia, multiple myeloma, mycosis fungoides, myelodysplasia, myelodysplastic/myeloproliferative neoplasms, myeloproliferative disorders, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian clear cell carcinoma, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, papillomatosis, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, respiratory tract cancer with chromosome 15 changes, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, supratentorial primitive neuroectodermal tumor, supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, cancer of the renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor;
• or
• (k) testing a biological sample of an individual to detect a mutation in an PPP2R1A gene;
• and
• (l) identifying the biological sample as containing cancer cells if the PPP2R1A gene comprises the mutation,
• wherein the mutation is selected from the group consisting of 547C>G, 547C>T, and 544C>T, wherein nucleotides are numbered by reference to SEQ ID NO:5;
• or
• (m) testing a biological sample of an individual to detect a mutation in an PPP2R1A gene;
• and
• (n) identifying the biological sample as containing cancer cells if the PPP2R1A gene comprises the mutation,
• wherein the mutation is selected from the group consisting of 547C>G, 547C>T, and 544C>T, wherein nucleotides are numbered by reference to SEQ ID NO:5.