Induced Heteroduplex Generators
AssigneeIHG Pharmaco Ltd.
InventorLouise Anne Tilley
Life of this patent
Estimating the term…
Abstract
Heteroduplex band resolution is found to be improved by modifying the induced heteroduplex generator (IHG) molecule such that the identifier is spaced apart from the nucleotide position immediately adjacent to the site of the polymorphism which is to be genotyped. Unexpectedly, it is found that, when such modified IHG molecules are used, the resolution of the induced heteroduplexes is significantly improved.
Claims24
1-35. (canceled)
A method for genotyping a target gene sequence associated with an inherited genetic disorder, comprising:
- (a) providing a population of induced heteroduplex generator (IHG) molecules corresponding to said target gene sequence, the IHG molecule being a synthetic DNA sequence including at least one nucleotide position which corresponds to a known polymorphic site in the genomic DNA sequence of the target gene sequence and at least one nucleotide substitution, deletion and/or insertion (“identifier”) relative to the genomic sequence at a nucleotide position spaced by a distance of at least one base from the nucleotide position which corresponds to the known polymorphic site and wherein the nucleotide(s) between the nucleotide position which corresponds to the polymorphic site and the identifier are unchanged from the genomic sequence;
- wherein the at least one identifier comprises an insertion of one or more bases and the IHG molecule is selected to provide improved separation of the resolved bands by a method comprising comparing the separation obtained using the IHG molecule with the separation obtained using a corresponding IHG in which the identifier is not so spaced;
- (b) providing a population of the target gene sequence;
- (c) combining the respective populations of (a) and (b) under conditions suitable for heteroduplex formation, to obtain induced heteroduplexes between the target gene sequence and an IHG molecule corresponding to said target gene sequence;
- (d) resolving the induced heteroduplexes into bands on a suitable support;
- and
- (e) analysing the resolved induced heteroduplexes to determine the genotype of the target gene sequence.
A method for predicting the likelihood that an organism, for example a human or other mammalian subject, will be susceptible to a particular genetic condition or disorder associated with a particular genotype, the method comprising genotyping in accordance with any one of the preceding claims a target gene sequence of the organism believed to be relevant to the genetic condition or disorder, and analyzing the results of the genotyping to predict the presence, absence, likelihood of the presence or absence, or severity of the particular condition or disorder in the organism.
Use, in genotyping the “−1082” polymorphism in the promoter of the IL-10 gene, of an IHG having the following sequence:
- AATCCAAGACAACACTACTAAGGCTTGTTTGGGAGAGAAAAGGGAAGTAG
- GGATAGGTAAGAGGAAAGTAAGGGACCTCCTATCCAG
Use, in genotyping the “−1082” polymorphism in the promoter of the IL-10 gene, of an IHG having the following sequence:
- AATCCAAGACAACACTACTAAGGCTTGTTTGGGAGAGAAAAGGGAAGTAG
- GGATAGGTAAGAGGAAAGTAAGGGACCTCCTATCCAG
Use, in genotyping the “−1082” polymorphism in the promoter of the IL-10 gene, of an IHG having the following sequence:
- AATCCAAGACAACACTACTAAGGCTTGTTTGGGAGAGGGAAAAGAAGTAG
- GGATAGGTAAGAGGAAAGTAAGGGACCTCCTATCCAG
Use, in genotyping the “−238” polymorphism in the Tumour Necrosis Factor gene, of an IHG having the following sequence:
- GTTCAGCCTCCAGGGTCCTACACACAAATCAGTGGCCCAGAAGACCCCCC
- TCAGAATCGGAAAAAGCAGGGAGGATGGGGAGTGTGAGGGGTATCCTTGA
- TGCTTGTGTGTCCCCAACTTTCCAAATCCC
Use, in genotyping the “−238” polymorphism in the Tumour Necrosis Factor gene, of an IHG having the following sequence:
- GTTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCAGAAGACC
- CCCCTCAGAATCGGAGAAAACAGGGAGGATGGGGAGTGTGAGGGGTATCC
- TTGATGCTTGTGTGTCCCCAACTTTCCAAATCCC
Dependencies are inferred from the claim text.