Strong insulator and uses thereof in gene delivery
AssigneeChildren's Hospital Medical Center
InventorPunam Malik
Life of this patent
Estimating the term…
Abstract
A strong insulator fragment from foamy virus, which can be used to insulate expression of a transgene and reduce genotoxicity of integrating vectors comprising such. The insulator fragment can also be used in gene targeting constructs in gene editing.
Claims24
A nucleic acid construct for gene delivery, the nucleic acid construct comprising at least one gene of interest (GOI) flanked by an insulator fragment, said insulator fragment consisting essentially of a nucleotide sequence having at least 90% sequence identity to AAGGGAGACATCTAGTGATATAAGTGTGAACT ACAC (SEQ ID NO:2) or at least 90% sequence identity to GTGTAGTTCACACTTATATCACTAGATGTCTCCCTT (SEQ ID NO:
- 1), said insulator fragment being heterologous to at least one fragment of said nucleic acid.
A nucleic acid consisting essentially of a nucleotide sequence at least 90% identical to SEQ ID NO:2 or at least 90% identical to GTGTAGTTCACACTTATATCACTAGATGTCTCCCTT (SEQ ID NO:
- 1), wherein the nucleic acid is an insulator, said insulator being heterologous to at least one fragment of said nucleic acid.
Dependencies are inferred from the claim text.