Back to results
US 11,898,143 B2Granted
Agents useful in treating facioscapulohumeral muscular dystrophy
AssigneeUniversite de Mons
InventorsAlexandra Belayew, Frederique Coppee, Celine Vanderplanck, Stephen Donald Wilton, Eugenie Ansseau
Life of this patent
Estimating the term…
Abstract
Antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy. Methods, uses and further products employing such agents are also described.
Claims30
An oligonucleotide of 20 to 30 nucleotides in length that comprises at least 20 consecutive nucleotides that are complementary to the nucleotide sequence set forth as SEQ ID NO:
- 12 (CTTCCTGGCTAGACCTGCGCGCAGT), wherein the oligonucleotide comprises one or more modifications.
Dependencies are inferred from the claim text.