Compositions and methods for detecting and treating insulin resistance
AssigneeThe Governing Council of the University of Toronto
InventorsDenise Belsham, Jennifer Chalmers
Life of this patent
Estimating the term…
Abstract
A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).
Claims21
A miR-1983 inhibitor that comprises an anti-miR-1983 oligonucleotide consisting of a nucleotide sequence selected from nucleotides 9 to 15, 8 to 15, 7 to 15, 6 to 15, 5 to 15, 4 to 15, 3 to 15, 2 to 15 or 1 to 15 of 5′-3′, A*C*A*T/U*G*C*T/U*C*C*A*G*G*T/U*G*A (SEQ ID NO:
- 2).
A method of improving insulin sensitivity in a subject, the method comprising administering a miR-1983 inhibitor to a subject in need thereof.
Dependencies are inferred from the claim text.