Back to results
US 11,299,734 B2Granted
RNA interference for the treatment of gain-of-function disorders
AssigneeUniversity of Massachusetts
InventorsNeil Aronin, Phillip D. Zamore
Life of this patent
Estimating the term…
Abstract
The present invention relates to the discovery of an effective treatment for a variety of gain-of-function diseases, in particular, Huntington's disease (HD). The present invention utilizes RNA Interference technology (RNAi) against polymorphic regions in the genes encoding various gain-of-function mutant proteins resulting in an effective treatment for the gain-of-function disease.
Claims9
A composition for treating or managing Huntington's disease, comprising an RNA silencing agent targeting UAAGAGAUGGGGACAGUACUUCAACGCUAGAAGAACA (SEQ ID NO:
- 43) of an Htt mRNA, such that RNA silencing of said mRNA occurs, wherein the RNA silencing agent comprises:
- (i) an antisense strand or a variant thereof having sufficient complementarity to SEQ ID NO:
- 43 to direct target-specific cleavage or translational repression of the Htt mRNA;
- (ii) a sense strand or a variant thereof that is substantially complementary to the antisense strand;
- and
- (iii) wherein the sense and antisense strands are capable of annealing together.
3 more elements
Dependencies are inferred from the claim text.