Method for treating schizophrenia

A method for treatment of schizophrenia or 22q11 deletion syndrome in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (i) miR-338-3p or a mimic or a functional derivative thereof, or (ii) a vector expressing said miR-338-3p or mimic or functional derivative thereof, or (iii) an agent capable of increasing the level or activity of miR-338-3p, wherein the miR-338-3p or mimic or derivative thereof comprises the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO:

• 1).