Continuously expressed therapeutic RNAs for targeted protein binding and methods for their use
AssigneeCity of Hope
InventorsKa Ming Pang, John J. Rossi
Life of this patent
Estimating the term…
Abstract
An RNA composition comprising an RNA aptamer and an shRNA molecule and/or an miRNA molecule are provided. The RNA composition may include an aptamer component that binds an enzymatic protein within a target cell and an shRNA and/or an miRNA component that facilitates trafficking of the aptamer within the target cell, such as, trafficking from the nucleus into the cytoplasm. The RNA aptamer and the shRNA and/or the miRNA component of the composition can be a fusion or independent molecules.
Claims13
An RNA composition comprising:
- an RNA aptamer molecule comprising a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) that targets an enzymatic protein;
- and
- an shRNA molecule that transports the RNA aptamer to a desired location, wherein the RNA aptamer molecule and the shRNA molecule are fused together.
A method of delivering a therapeutic agent to an HIV-infected cell comprising:
- contacting the HIV-infected cell with an RNA composition, wherein the RNA composition comprises an RNA aptamer component fused to a therapeutic agent component comprising an shRNA molecule;
- and
- wherein the RNA aptamer comprises a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) and binds an enzymatic protein expressed by non-host DNA or non-host RNA, resulting in inhibition of activity of the enzymatic protein.
A pharmaceutical composition:
- comprising an RNA composition, wherein the RNA composition comprises an RNA aptamer having a nucleotide sequence of CGTATGGGTGAGCCCGTTAAGATTGCGCGT (SEQ ID NO:1) that specifically binds an enzymatic protein fused to an shRNA molecule, and a pharmaceutically acceptable carrier.
Dependencies are inferred from the claim text.