Compositions of ascorbic acid and bone morphogenetic protein 4 (BMP-4) for cell growth and uses related thereo
AssigneeEmory University
InventorsYoung-Sup Yoon, Jaeyeaon Cho
Life of this patent
Estimating the term…
Abstract
This disclosure relates to compositions comprising ascorbic acid and bone morphogenetic protein 4 (BMP-4) for growing cells and making tissues. In certain embodiments, this disclosure relates to methods of creating cardio-mimetic tissues (CMTs) by culturing the cells in the presence of ascorbic acid and bone morphogenetic protein 4 and optionally inserting into cells a muscle specific microRNA or related nucleobase polymer and under conditions such that a cardio-mimetic tissue is formed that is capable of spontaneously contracting.
Claims14
A method of making cardio-mimetic tissue by mixing fibroblast cells with ascorbic acid and bone morphogenetic protein 4 and inserting into the fibroblast cells a nucleobase polymer with a nucleotide sequence consisting of or comprising a sequence selected from AUAAGACGAACAAAAGGUUUGU (SEQ ID NO:
- 1), or variant with 65% or greater identity thereto, and under conditions such that a tissue is formed that is capable of spontaneously contracting.
A method of treating heart disease comprising,
- isolating fibroblast cells from a subject diagnosed with heart disease thereby providing isolated fibroblast cells;
- making cardio-mimetic tissue capable of spontaneously contracting by the process of inserting or expressing inside the isolated fibroblast cells a nucleobase polymer comprising a nucleotide sequence consisting of or comprising AUAAGACGAACAAAAGGUUUGU (SEQ ID NO:
- 1), or variant with 65% or greater identity thereto, and then contacting the isolated fibroblast cells with ascorbic acid and bone morphogenetic protein 4 under conditions such that a tissue capable of spontaneously contracting is formed thereby providing a cardiomimetic tissue;
- and
- implanting the cardio-mimetic tissue effectively on or in the heart of the subject.
A method of treating heart disease comprising administering an effective amount of ascorbic acid or prodrug thereof and bone morphogenetic protein 4 in combination with an expression vector encoding a nucleobase polymer comprising sequence AUAAGACGAACAAAAGGUUUGU SEQ ID NO:
- 1 or variant with 65% or greater identity thereto, to a subject in need thereof, wherein administration is by injection into a peritoneal cavity or heart of the subject.
Dependencies are inferred from the claim text.