Endoribonuclease compositions and methods of use thereof
AssigneeThe Regents of the University of California
InventorsRachel E. Haurwitz, Jennifer A. Doudna, Blake Wiedenheft, Martin Jinek
Life of this patent
Estimating the term…
Abstract
The present disclosure provides variant Csy4 endoribonucleases, nucleic acids encoding the variant Csy4 endoribonucleases, and host cells genetically modified with the nucleic acids. The variant Csy4 endoribonucleases find use in a variety of applications, which are also provided. The present disclosure also provides methods of detecting a specific sequence in a target polyribonucleotide; and methods of regulating production of a target RNA in a eukaryotic cell.
Claims15
An in vitro method of regulating production of a target RNA from a precursor RNA in a eukaryotic cell, the method comprising:
- introducing into said eukaryotic cell a recombinant expression vector comprising a nucleotide sequence encoding an enzymatically active sequence-specific Csy4 endoribonuclease, wherein the Csy4 endoribonuclease comprises an amino acid sequence having at least 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:8, wherein the target RNA comprises a GUUCACUGCCGUAUAGGCAG (SEQ ID NO:103) cleavage site in a precursor RNA comprising the target RNA, and wherein said Csy4 endoribonuclease is produced in the cell and cleaves said target RNA from the precursor RNA at the cleavage site, thereby regulating production of the target RNA.
Dependencies are inferred from the claim text.