Detection and destruction of cancer cells using programmed genetic vectors

A composition comprising a vector for transfecting a cell, the vector comprising:

• a) a first nucleic acid sequence encoding an antisense agent, said antisense agent comprising a first RNA interference target for a transcript of a gene that is endogenous to the cell and that is a biomarker for disease, and
• b) a second nucleic acid sequence comprising
• i) a third nucleic acid sequence encoding a cell-killing agent, and
• ii) a fourth nucleic acid sequence comprising a second RNA interference target that is substantially complementary to said first RNA interference target,
• wherein said third nucleic acid sequence is fused to said fourth nucleic acid sequence, wherein, in the presence of said biomarker, said third nucleic acid sequence and said fourth nucleic acid sequence are expressed, and wherein, in the absence of said biomarker, binding of said second RNA interference target to said second RNA interference target inhibits expression of said cell-killing agent, and wherein said antisense agent does not alter protein translation by said second RNA interference target, and wherein
• 1) said first RNA interference target is selected from the group consisting of GATA3 antisense sequences CGAGTCGCTGAAGAGGTTCTG (SEQ ID NO:1), CGAGTCGCTGAAGAGGTTCTGCUUCAAGAGAGCAGAACCTCTTCAGC GACTCG (SEQ ID NO:3), GTAAGTGGTATAATTGTCTGG (SEQ ID NO:6), and
• GTAAGTGGTATAATTGTCTGGCUUCAAGAGAGCCAGACAATTATACCA CTTAC (SEQ ID NO:8),
• 2) said cell-killing agent is selected from the group consisting of BAK protein and BAX protein, and
• 3) said second RNA interference target is selected from the group consisting of GATA3 mRNA sequences CAGAACCTCTTCAGCGACTCG (SEQ ID NO:5) and CCAGACAATTATACCACTTAC (SEQ ID NO:10).