# US 9,434,948 B2 · Multiple exon skipping compositions for DMD

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 9,434,948 B2
- Document ID: US9434948B2
- Status: Granted
- Kind: B2
- Application number: 14/852,264
- Filed: 2015-09-11
- Published: 2015-12-31
- Granted: 2016-09-06
- Earliest claimed: 2008-10-24
- Assignees: Sarepta Therapeutics, Inc.
- Applicants: Sarepta Therapeutics, Inc.
- Inventors: Peter Sazani; Ryszard Kole
- Web page: https://patentgrep.com/patent/US9434948B2

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61P 21/00: Drugs for disorders of the muscular or neuromuscular system
- A61P 21/04: for myasthenia gravis
- C12N 15/111: {General methods applicable to biologically active non-coding nucleic acids}
- C12N 2310/11: Antisense
- C12N 2310/321: 2'-O-R Modification
- C12N 2310/3233: Morpholino-type ring
- C12N 2310/331: Universal or degenerate base
- C12N 2310/3341: 5-Methylcytosine
- C12N 2310/3513: Protein; Peptide
- C12N 2320/30: Special therapeutic applications
- C12N 2320/33: Alteration of splicing
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

## Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

## Claims

### Claim 1

An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

### Claim 2

An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

### Claim 3

An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

### Claim 4

An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO:285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof.

### Claim 5

A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which thymine bases are uracil bases, wherein the antisense oligonucleotide is a 2′-O- methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

### Claim 6

A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

### Claim 7

A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases and (ii) one or more of the bases are hypoxanthine, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

### Claim 8

A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 50 of the human dystrophin pre-mRNA, wherein the base sequence comprises 17 consecutive bases of AGGCTCCAATAGTGGTCAGTCCAGG (SEQ ID NO: 285), in which: (i) thymine bases are uracil bases, (ii) one or more of the bases are hypoxanthine, and (iii) cytosine bases are 5-methylcytosine bases, wherein the antisense oligonucleotide is a 2′-O-methyl oligonucleotide, and wherein the antisense oligonucleotide induces exon 50 skipping; or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.