Back to results
US 9,309,516 B2Granted
Selection of RNA-aptamers as anti-malaria agents
AssigneeAptahem AB
InventorsJohan Lindh, Tina Persson
Life of this patent
Estimating the term…
Abstract
The present invention relates to an aptamer or an active fragment thereof raised against the semi-conserved duffy binding ligand domain 1α, DBL1α, region of the Plasmodium falciparum erythrocyte membrane protein 1, PfEMPI, which aptamer has an effect against malaria, in particular severe cerebral malaria.
Claims4
An aptamer comprising:
- (SEQ. ID. NO. 4)
- UAGCUCACCACACCAGCAAUCAACGCGUUUUUUCAAACACUGGCACAUGA.
An aptamer which is a fluorinated aptamer of SEQ ID NO:
- 4 having sequence:
- (SEQ. ID. NO. 10)
- UFAGCFUFCFACFCFACFACFCFAGCFAAUFCFAACFGCFGUFUFUFUFUF
- UFCFAAACFACFUFGGCFACFAUFGA.
1 more element
Dependencies are inferred from the claim text.