Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138
AssigneeAgency for Science, Technology and Research
InventorPrabha Sampath
Life of this patent
Estimating the term…
Abstract
Methods for malignant glioma diagnosis/prognosis using miR-138 as a prognostic biomarker and methods for treating malignant glioma and inhibiting glioma stem cell growth by suppressing miR-138. Also disclosed herein are pharmaceutical compositions for use in treating malignant glioma, prolonging survival of malignant glioma patients, or eliminating GSCs and in turn tumor growth, the pharmaceutical composition comprising an oligonucleotide that targets miR-138.
Claims3
A pharmaceutical composition, comprising an oligonucleotide targeting miR-138, wherein the oligonucleotide comprises the nucleotide sequence of 5′-GAGCTGGTATTGTGAATCAAGCAGCTTCCTGTCAGCGGCCTGATTCACA ACACCAGCTTTTTT3′ (SEQ ID NO:2).
Dependencies are inferred from the claim text.