Back to results
US 8,945,831 B2Granted
Compositions and methods for detecting juvenile renal dysplasia or calcium oxalate stones in dogs
AssigneeDOGenes Inc.
InventorMary Helen Whiteley
Life of this patent
Estimating the term…
Abstract
The application relates to Canine Cox2 allelic variants associated with Juvenile Renal Dysplasia, primer and probe compositions and methods and kits useful in detecting, monitoring and diagnosing Juvenile Renal Dysplasia or calcium oxalate stones.
Claims5
A method of genotyping a dog to detect the presence of an allelic variant in the 5′UTR of Cox2 comprising:
- (a) providing a sample containing DNA from a dog;
- (b) contacting DNA from the sample with a PCR primers comprising SEQ ID NO:13 and SEQ ID NO:14;
- (c) detecting the allelic variant of (i) a deletion of 6 nucleotides starting at position −68/−73 and a deletion of 11 nucleotides starting at position −37 of the canine Cox2 gene;
- (ii) an insertion of 12 nucleotides at position −78 of the canine Cox2 gene, wherein the insertion comprises the nucleotide sequence CGCCTCCGCCTC (SEQ ID NO:31);
- and/or (iii) an insertion of 24 nucleotides at position −78 of the canine Cox2 gene, wherein the insertion comprises the nucleotide sequence CGCCTCCGCCTCCGCCTCCGCCGC (SEQ ID NO:32);
- wherein detecting the allelic variant comprises amplifying the nucleotide sequence using the PCR primers;
- and
- (d) identifying the dog as having the allelic variant in the 5′UTR of Cox2.
5 more elements
A method of genotyping a dog to detect the presence of an allelic variant in the 5′UTR of Cox2 comprising:
- (a) providing a sample containing DNA from a dog, wherein the dog is a Lhasa Apso or German Shepherd dog;
- (b) contacting DNA from the sample with PCR primers comprising SEQ ID NO:13 and SEQ ID NO:14;
- (c) detecting the allelic variant of:
- (i) a deletion of 6 nucleotides starting at position −68/−73 and a deletion of 11 nucleotides starting at position −37 of the canine Cox2 gene, wherein the dog is a German Shepherd dog;
- or
- (ii) an insertion of 12 nucleotides at position −78 of the canine Cox2 gene, wherein the insertion comprises the nucleotide sequence CGCCTCCGCCTC (SEQ ID NO:31) and/or an insertion of 24 nucleotides at position −78 of the canine Cox2 gene, wherein the insertion comprises the nucleotide sequence CGCCTCCGCCTCCGCCTCCGCCGC (SEQ ID NO:32);
- wherein the dog is a Lhasa Apso dog;
- wherein detecting the allelic variant comprises amplifying the nucleotide sequence using the PCR primers;
- and
- (d) identifying the dog as having the allelic variant in the 5′UTR of Cox2.
7 more elements
Dependencies are inferred from the claim text.