Specific ligand for annexin 2
AssigneeCommissariat A L'energie Atomique Et Aux Energies Alternatives
InventorsFrédéric Duconge, Agnès Cibiel
Life of this patent
Estimating the term…
Abstract
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
Claims11
An aptamer comprising a nucleic acid comprising, or consisting of SEQ ID NO:
- 1 or 2, or a sequence comprising, or consisting of, at least 25 consecutive nucleotides of a sequence having at least 80% identity with SEQ ID NO:
- 1 or 2, wherein the nucleic acid consisting of this sequence binds to annexin 2.
Dependencies are inferred from the claim text.