Clusterin antisense therapy for treatment of cancer
AssigneeThe University of British Columbia
InventorsMartin E. Gleave, Scott D. Cormack
Life of this patent
Estimating the term…
Abstract
A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.
Claims32
A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer comprising administering from 480 mg to 640 mg anti-clusterin antisense oligonucleotide intravenously to a human in need of treatment for a cancer expressing clusterin, which human also receives hormone ablation therapy, radiation therapy or a chemotherapeutic agent, wherein the nucleotide sequence of the anti-clusterin antisense oligonucleotide is CAGCAGCAGAGTCTTCATCAT (Seq. ID No.:
- 1), wherein the anti-clusterin antisense oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of prostate cancer comprising administering intravenously 640 mg anti-clusterin antisense oligonucleotide in an aqueous solution once in a seven day period to a human in need of treatment for prostate cancer expressing clusterin, which human also receives docetaxel and prednisone, wherein the nucleotide sequence of the anti-clusterin antisense oligonucleotide is CAGCAGCAGAGTCTTCATCAT (Seq. ID No.:
- 1), wherein the anti-clusterin antisense oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of non-small cell lung cancer comprising administering intravenously 640 mg anti-clusterin antisense oligonucleotide in an aqueous solution once in a seven day period to a human in need of treatment for non-small cell lung cancer expressing clusterin, which human also receives paclitaxel and carboplatin, wherein the nucleotide sequence of the anti-clusterin antisense oligonucleotide is CAGCAGCAGAGTCTTCATCAT (Seq. ID No.:
- 1), wherein the anti-clusterin antisense oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
Dependencies are inferred from the claim text.