Method for early diagnosis of carcinomas of the anogenital tract
AssigneeOncgnostics GmbH
InventorsMatthias Dürst, Alfred Hansel, Daniel Steinbach
Life of this patent
Estimating the term…
Abstract
A method for the early diagnosis of carcinomas of the anogenital tract, preferably of the cervical carcinoma, and the preliminary stages thereof is described. The method is based on the determination of the methylation status of segments of the gene regions of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein 671, transcription factor). A DNA methylation in the promoter region or the 5′-region of these genes is indicative for carcinomas of the anogenital tract or severe preliminary stages thereof. The present invention also relates to kits which permit the conduction of the diagnostic method according to the invention.
Claims20
A method for detecting anogenital cancer or preliminary stages thereof in a sample, comprising determining the methylation status of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein, transcription factor), wherein ASTN1 and/or ZNF671 are methylated in a positive sample, and wherein primer pairs are used which comprise the following sequences:
- (a)
- CGTAAGCGTTGTTAGCGTAGC (ASTN1_F)
- (SEQ ID No.:
- 1)
- and
- CGCGAAATCGAAACGAAAACG (ASTN1_R);
- (SEQ ID No.:
- 2)
- (b)
- CGGAGGACGTAGTATTTATTCGC (ZNF671_F)
- (SEQ ID No.:
- 11)
- and
- CTACGTCCCCGATCGAAACG (ZNF671_R).
- (SEQ ID No.:
- 12)
A kit for detecting anogenital cancer or preliminary stages thereof in a sample, comprising:
- gene specific primer pairs that determine methylation and/or hypermethylation of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein, transcription factor).
Dependencies are inferred from the claim text.