# US 8,541,559 B2 · Process for producing aggregated oligonucleotides

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 8,541,559 B2
- Document ID: US8541559B2
- Status: Granted
- Kind: B2
- Application number: 12/304,620
- Filed: 2007-06-12
- Published: 2010-10-28
- Granted: 2013-09-24
- Earliest claimed: 2006-06-12
- Assignees: Cytos Biotechnology AG
- Applicants: Matthias Kinzler; Karl Proba
- Inventors: Matthias Kinzler; Karl Proba
- Web page: https://patentgrep.com/patent/US8541559B2

## CPC

- C12N 15/86: Viral vectors
- A61P 37/04: Immunostimulants
- C07H 21/04: with deoxyribosyl as saccharide radical
- C12N 7/00: Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof (preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K39/00)
- C12N 15/117: Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
- A61K 2039/5258: {Virus-like particles}
- C12N 2310/17: Immunomodulatory nucleic acids
- C12N 2320/32: Special delivery means, e.g. tissue-specific
- C12N 2795/00034: Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
- C12N 2795/18122: New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
- C12N 2795/18123: Virus like particles [VLP]
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C07H: SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS (derivatives of aldonic or saccharic acids C07C, C07D; aldonic acids, saccharic acids C07C59/105, C07C59/285; cyanohydrins C07C255/16; glycals C07D; compounds of unknown constitution C07G; polysaccharides, derivatives thereof C08B; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification C12N15/00; sugar industry C13)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

The invention provides processes for the producing compositions comprising (i) a virus-like particle, wherein said virus-like particle is a virus-like particle of an RNA bacteriophage, and (ii) an oligonucleotide, wherein said oligonucleotide is packaged into said virus-like particle. The invention further provides processes for producing nucleotide compositions comprising oligonucleotides suitable to be used in the processes mentioned before. The invention further provides nucleotide compositions obtainable by the processes of the invention and uses thereof. The invention further provides compositions comprising (i) a virus-like particle, wherein said virus-like particle is a virus-like particle of an RNA bacteriophage, and (ii) an oligonucleotide, wherein said oligonucleotide is packaged into said virus-like particle, wherein said compositions are obtainable by the processes of the invention and wherein said compositions preferably comprises a purity of at least 98%, most preferably of at least 99%.

## Claims

### Claim 1

A process for producing an nucleotide composition comprising aggregated oligonucleotides, said process comprising the steps of:
(a) providing at least two oligonucleotides in solution I, wherein said oligonucleotides comprise at their 5′ end at least 3 and at most 15 guanosine entities and at their 3′ end at least 3 and at most 15 guanosine entities, wherein each oligonucleotide of said oligonucleotides comprise 20 to 40 nucleotides, and wherein said solution I comprises a pH of 10 to 13;
(b) disaggregating said oligonucleotides, wherein said disaggregating comprises the steps of
(i) adjusting the temperature of solution I to temperature I, wherein said temperature I is 20 to 70° C.;
(ii) incubating said oligonucleotides in said solution I at said temperature I, wherein said incubating is performed until said oligonucleotides comprise a relative peak start time above 110%, and wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard; and
(iii) adjusting the temperature of said solution I to temperature II, wherein said temperature II is 0 to 10° C.;
(c) adjusting the pH of said solution I to 5 to 8; and
(d) aggregating said oligonucleotides, wherein said aggregating comprises the steps of:
(i) providing said oligonucleotides in said solution I and generating a solution II, wherein said solution II further comprises at least 20 mM of a cation, wherein said cation is selected from the group consisting of Na+, NH4+, Li+, Ca2+, and Mg2+;
(ii) adjusting the temperature of solution II to temperature III, wherein said temperature III is 50 to 99° C.;
(iii) incubating said oligonucleotides in solution II at temperature III, wherein said incubating is performed until said oligonucleotides comprise a relative peak start time of 80 to 110%, wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard; and
(iv) adjusting the temperature of solution II to temperature IV, wherein said temperature IV is 0 to 10° C.

### Claim 2 (depends on 1)

The process of claim 1, wherein said temperature I is 45 to 70° C.

### Claim 3 (depends on 1)

The process of claim 1, wherein said adjusting of the temperature of said solution I to temperature II is performed with a temperature ramp of at least 3.6° C./min.

### Claim 4 (depends on 1)

The process of claim 1, wherein said solution I comprises potassium hydroxide or sodium hydroxide.

### Claim 5 (depends on 1)

The process of claim 1, wherein said adjusting of the pH of said solution I is performed by the addition of phosphoric acid, and wherein said adjusting of the pH of said solution I is performed until said pH is 6 to 7.

### Claim 6 (depends on 1)

The process of claim 1, wherein said cation is Na+ or K+, and wherein said solution II comprises 200 to 275 mM of said cation.

### Claim 7 (depends on 1)

The process of claim 1, wherein the concentration of said oligonucleotides in said solution I is 50 μM to 2 mM.

### Claim 8 (depends on 1)

The process of claim 1, wherein the concentration of said oligonucleotides in said solution II is 50 μM to 2 mM.

### Claim 9 (depends on 1)

The process of claim 1, wherein said incubating of said oligonucleotides in solution II at temperature III is performed until said oligonucleotides comprise a relative peak start time of 80 to 95%, and wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard.

### Claim 10 (depends on 1)

The process of claim 1, wherein said oligonucleotides comprise a nucleic acid sequence selected from the group consisting of:
(a) “G4-4”
GGGGGACGATCGTCGGGG;
(SEQ ID NO: 2)
(b) “G5-5”
GGGGGGACGATCGTCGGGGG;
(SEQ ID NO: 3)
(c) “G6-6”
GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 4)
(d) “G7-7”
GGGGGGGGACGATCGTCGGGGGGG;
(SEQ ID NO: 5)
(e) “G8-8”
GGGGGGGGGACGATCGTCGGGGGGGG;
(SEQ ID NO: 6)
(f) “G9-9”
GGGGGGGGGGACGATCGTCGGGGGGGGG;
(SEQ ID NO: 7)
(g) “G10”
GGGGGGGGGGGACGATCGTCGGGGGGGGGG;
(SEQ ID NO: 8)
(h) “G11”
GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG.
(SEQ ID NO: 9)

### Claim 11 (depends on 1)

The process of claim 1, wherein said oligonucleotides comprise the nucleic acid sequence “G10” GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:8).

### Claim 12 (depends on 1)

The process of claim 1, wherein said adjusting the temperature of solution II to temperature IV is performed with a temperature ramp of at least 3.6° C./min.

### Claim 13 (depends on 1)

The process of claim 1, wherein said oligonucleotides comprise a palindromic sequence, wherein said palindromic sequence is GACCATCGTC (SEQ ID NO:1).

### Claim 14 (depends on 1)

The process of claim 1, wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage Qβ as the standard.

### Claim 15 (depends on 9)

The process of claim 9, wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage Qβ as the standard.

### Claim 16 (depends on 1)

The process of claim 1, wherein said temperature I is room temperature.

### Claim 17 (depends on 1)

The process of claim 1, wherein said temperature I is about 50° C.

### Claim 18 (depends on 1)

The process of claim 1, wherein said temperature II is 0 to 2° C.

### Claim 19 (depends on 1)

The process of claim 1, wherein said temperature IV is 0 to 2° C.

### Claim 20 (depends on 1)

The process of claim 1, wherein said oligonucleotides consist of the nucleic acid sequence “G10” GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:8).