Back to results
US 8,507,664 B2Granted
Oligonucleotidic sequences able to silence the expression of the CYCLIN D1-TROP2 chimera and uses thereof in medical field
AssigneeSaverio Alberti
InventorsSaverio Alberti, Emanuela Guerra
Life of this patent
Estimating the term…
Abstract
The invention concerns RNA oligonucleotide sequences or sequences that are transcribed into RNA or analogous molecules able to silence the expression of the CYCLIN D1/TROP2 chimeric mRNA and their use in the treatment and the prevention of tumors.
Claims12
Oligonucleotide sequence (siRNA) able to silence the expression of the CYCLIN D1/TROP2 chimeric mRNA, said siRNA being characterized by the fact that it comprises a ribonucleotide sequence complementary to the CYCLIN D1/TROP2 chimeric mRNA junction sequence 5′GAGAGAGAGAGAAAGGAGCCC 3′ (SEQ ID NO:21).
Dependencies are inferred from the claim text.