Isolated reductive dehalogenase genes
AssigneeGeorgia Tech Research Corporation
InventorsFrank Loeffler, Kirsti M. Ritalahti, Rosa Krajmalnik-Brown, Ivy Thomson
Life of this patent
Estimating the term…
Abstract
The invention is directed to novel reductive dehalogenase genes encoding for reductive dehalogenases which are capable of dehalogenating halogenated organic compounds and may be useful in the bioremediation of pollutants. In particular, the invention provides an isolated polynucleotide of a novel vinyl chloride dehalogenase gene (bvcA). The novel vinyl chloride dehalogenase gene encodes a reductive dehalogenase that is capable of the complete reduction of vinyl chloride to ethene.
Claims18
An isolated polynucleotide encoding a reductive dehalogenase comprising a polynucleotide sequence having at least 95% sequence identity over the length of the entire reference sequence to a sequence selected from the group consisting of SEQ ID NO:
- 1 and SEQ ID NO:
- 7.
An isolated polynucleotide, wherein the polynucleotide comprises the sequence AAAAGCACTTGGCTATCAAGGAC (SEQ ID NO:
- 23).
An isolated polynucleotide, wherein the polynucleotide comprises the sequence TGGTGGCGACGTGGCTATGTGG (SEQ ID NO:
- 25).
An isolated polynucleotide, wherein the polynucleotide comprises the sequence CCAAAAGCACCACCAGGTC (SEQ ID NO:
- 24).
Dependencies are inferred from the claim text.