Probe, probe set, probe carrier, and testing method
AssigneeCanon Kabushiki Kaisha
InventorsNobuhiro Tomatsu, Toshifumi Fukui, Nobuyoshi Shimizu, Atsushi Takayanagi
Life of this patent
Estimating the term…
Abstract
A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 3 and mutated sequences thereof.
Claims6
A probe set for detecting the internal transcribed spacer (ITS) of a DNA of Arthroderma gypseum which is a pathogenic fungus, comprising the following three probes (1) to (3) to specifically detect the ITS region of the DNA of Arthroderma gypseum:
- (1) a probe consisting of gtccggggacaatcaactccct (SEQ ID NO. 1) or the complementary sequence thereof;
- (2) a probe consisting of aatccatgaatactgttccgtctgagc (SEQ ID NO. 2) or the complementary sequence thereof;
- and
- (3) a probe consisting of ggccggttttctggcctagtttt (SEQ ID NO. 3) or the complementary sequence thereof.
A probe set for detecting the internal transcribed spacer (ITS) region of a DNA of Arthroderma gypseum which is a pathogenic fungus, comprising the following probes (A) to (C), wherein the probe set does not comprise another probe to detect the ITS region of the DNA of Arthroderma gypseum:
- (A) a probe consisting of a base sequence represented by gtccggggacaatcaactccct (SEQ ID NO. 1);
- (B) a probe consisting of a base sequence represented by aatccatgaatactgttccgtctgagc (SEQ ID NO. 2);
- and
- (C) a probe consisting of a base sequence represented by ggccggttttctggcctagtttt (SEQ ID NO. 3).
Dependencies are inferred from the claim text.