Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal

#This application is a U.S. national-stage patent application from international application PCT/CA06/000868, filed May 29, 2006, which claims the benefit of priority to U.S. Provisional Patent Application No. 60/685,269, filed May 27, 2005. The contents and disclosure of these application(s) are hereby incorporated by reference in their entirety.

#This invention relates generally to the benefits of elevated expression of Integrin Linked Kinase (ILK), particularly to the cardioprotective effect evidenced as a result of upregulation of ILK post myocardial infarction, and most particularly to ILK mediated reduction of infarct size and beneficial increase in left ventricular mass post MI and to use of ILK as a means for cardiac stem cell proliferation and self-renewal.

#The major barrier to the use of stem cell therapy in regenerative medicine is the inability to regulate the dichotomous capacity for stem cell self-renewal versus the process of cell lineage commitment. The solution to this problem will require an improved understanding of the inductive signals and the cognate signal transduction pathways which determine cellular fate, and which specifically govern the competitive outcomes of self-renewal with maintenance of pluripotency, versus differentiation into a specialized tissue phenotypei.

#FIG. 1: ILK expression in normal and hypertrophied human ventricles: a, Ventricular lysates from patients with congenital outflow tract obstruction (H1, H2), exhibiting severe hypertrophic valvular heart disease, and from (non-hypertrophic) normal human fetal (19 weeks old) ventricle (N1, N2), were immunoblotted for levels of ILK protein, with GAPDH as loading control. Ratios indicate ILK protein levels normalized to GAPDH. b, Ventricular lysates from hypertrophic (HOCM) and normal (non-hypertrophied) human hearts were analyzed by western blotting for levels of ILK and ParvB. GAPDH was the loading control.

#FIG. 2 Rac, Rho and Cdc42 expression in human heart tissue: a, Normal and hypertrophic (HOCM) human ventricular lysates (FIG. 1) were assayed for activation of Rho family GTPases, as indicated. b, Ventricular lysates from the congenital samples (H1, H2) and normal human fetal hearts (19 weeks, FIG. 1) were assayed for Rho family activation. Ratios represent densitometric values of activated/total GTPase signals for Rho, Rac1 and Cdc42.

#FIG. 3: Phosphorylation of GSK3β, PKB, and MAP kinase in human heart tissue: a, Ventricular lysates labeled N1, N2, H1 and H2 were as in FIGS. 1 and 2, above. b and c, Ventricular lysates from normal and hypertrophic human adult hearts, were as in FIGS. 1 and 2. Lysates were resolved by SDS-PAGE and analyzed by western blotting for levels of the indicated total and phosphorylated proteins.

#Generation of α-MHC-ILK Transgenic Mice

#All protocols were in accordance with institutional guidelines for animal care. All procedures and analyses were performed in a fashion blinded for genotype, and statistical comparisons were made between ILK transgenic mice and sex-matched littermate non-transgenic mice. A 1.8 kb EcoRI fragment comprising the full length ILK cDNA was excised from a pBSK plasmid, and filled-in for blunt end ligation into a SalI site downstream of the murine a-myosin heavy chain promoter. Site directed mutagenesis (QuickChange Kit, Stratagene) was performed to generate constitutively active ILK (S343D), and kinase-inactive ILK (R211A) mutants using the wild type a-MHC/ILK plasmid as template. DNA sequencing confirmed the point mutations. Pronuclear microinjection of the linearized a-MHC/ILK plasmids into 0.5 day fertilized embryos was performed at the Core Transgenic Facility of the Hospital for Sick Children Research Institute. Transgene expression in C57BL/6 founder and F1 progeny mice was confirmed by Southern analysis and RT-PCR as described, using primers specific for the exogenous ILK transgene. The forward primer: 5′GTCCACATTCTTCAGGATTCT3′, specific for exon 2 of −MHC promoter, and the ILK-specific reverse primer: ‘ACACAAGGGGAAATACC GT3’, were used for the reaction. These primers amplify a 1460 bp across the α-MHC-ILK fusion junction. F1 progeny derived from one of several independent founder lines were selected for detailed phenotypic analysis based on readily discernible increases in ILK expression (FIG. 4). All transgenic mouse procedures were performed in conformance with the policies for humane animal care governing the Core Transgenic Facility of the Hospital for Sick Children Research Institute and the Animal Research Act of Ontario.

#Cardiac Hemodynamic Measurements