Loading patent…
AssigneesMerial Limited, The Regents of the University of California
InventorsJean Christophe Francis Audonnet, Kemal Karaca, Jiansheng Yao, Nigel James MacLachlan
Estimating the term…
The present invention relates to an immunogenic or vaccine composition to induce an immune response or protective immune response against Orbiviruses, more specifically bluetongue virus (BTV) in an animal susceptible to BTV infection. The composition may include a pharmaceutically or veterinarily acceptable vehicle or excipient, and a vector. The vector may contain heterologous nucleic acid molecule(s), expresses in vivo in the animal BTV antigen, immunogen or epitope thereof, e.g., BTV VP2; BTV VP2 and VP5; BTV VP2 and VP5 and VP3 and/or VP7. The composition can contain an adjuvant, such as carbomer. Methods for making and using such a composition, including prime-boost regimes and including as to differential diagnosis, are also contemplated. AGACAGTGGTCAATTCCAATGGTACTGTTTGACGATAC
An immunogenic composition comprising a recombinant poxvirus, wherein the recombinant poxvirus comprises nucleic acid molecules encoding Bluetongue Virus (BTV) VP2 having the sequence as set forth in SEQ ID NO:20 and BTV VP5 having the sequence as set forth in SEQ ID NO:21.
An immunogenic composition comprising a recombinant poxvirus comprising one or more nucleic acid molecules, wherein the one or more nucleic acid molecules comprise the sequence as set forth in SEQ ID NO:1, or the sequence as set forth in SEQ ID NO:2, or combinations thereof.
Dependencies are inferred from the claim text.