Development of diagnostic kit for the detection of Chrysanthemum virus B
AssigneeCouncil of Scientific and Industrial Research
InventorsLakhmir Singh, Vipin Hallan, Aijaz Ashgar Zaidi
Life of this patent
Estimating the term…
Abstract
The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies against Chrysanthemum virus B coat protein in plants; conjugate labeled with alkaline phosphatase; coating buffer; extraction buffer; ECI buffer; PNP buffer.
Claims9
A method for detection of Chrysanthemum virus B (CVB) in plants, comprising the steps of:
- a) immunizing an animal with a recombinant CVB coat protein comprising the amino acid sequence of SEQ ID NO:
- 3, and isolating polyclonal antibodies against CVB;
- b) using the polyclonal antibodies in a direct antibody sandwich enzyme linked immunosorbent assay (DAS ELISA) to detect CVB in a plant sample.
A method for detection of Chrysanthemum virus B (CVB) in plants, comprising the steps of:
- a) amplifying a CVB coat protein coding sequence from a sample, using a forward primer consisting of the nucleotide sequence of SEQ ID NO:
- 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO:
- 2, cloning said coat protein coding sequence into an expression vector, and producing a recombinant CVB coat protein by expression from said vector, wherein said recombinant CVB coat protein comprises the amino acid sequence of SEQ ID NO:
- 3;
- b) immunizing an animal with said recombinant CVB coat protein and isolating polyclonal antibodies against CVB;
- c) using the polyclonal antibodies in a direct antibody sandwich enzyme linked immunosorbent assay (DAS ELISA) to detect CVB in a plant sample.
Dependencies are inferred from the claim text.