TRPM-2 antisense therapy
AssigneeThe University of British Columbia
InventorsMartin Gleave, Paul S. Rennie, Hideaki Miyake, Colleen Nelson
Life of this patent
Estimating the term…
Abstract
Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.
Claims5
A pharmaceutical composition, comprising an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and a pharmaceutically acceptable carrier suitable for human administration for providing the oligonucleotide to a mammalian subject to reduce expression of TRPM-2 wherein the antisense oligonucleotide comprises the sequence given by SEQ ID No. 4.
An oligonucleotide consisting of the sequence set forth in Seq. ID No. 4.
Dependencies are inferred from the claim text.