# US 7,608,398 B2 · Polynucleotides for use tags and tag complements, manufacture and use thereof

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 7,608,398 B2
- Document ID: US7608398B2
- Status: Granted
- Kind: B2
- Application number: 11/729,302
- Filed: 2007-03-28
- Published: 2007-10-18
- Granted: 2009-10-27
- Earliest claimed: 2001-01-25
- Assignees: Luminex Molecular Diagnostics, Inc.
- Inventors: Petr Pancoska; Vit Janota; Albert S. Benight; Richard S. Bullock; Peter V. Riccelli; Daniel Kobler; Daniel Fieldhouse
- Web page: https://patentgrep.com/patent/US7608398B2

## CPC

- C12Q 1/6876: Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q 1/6855: Ligating adaptors
- Y10T 436/13: Tracers or tags
- Y10T 436/143333: Saccharide [e.g., DNA, etc.]
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- Y10T: TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION

## Abstract

A family of minimally cross-hybridizing nucleotide sequences, methods of use, etc. A specific family of 210 24mers is described.

## Claims

### Claim 1

An oligonucleotide tag or tag complement for use in a multiplex assay, wherein the tag or tag complement is selected from the group of oligonucleotides consisting of:
TGAATTGATGAATGAATGAAGTAT,
(SEQ ID NO. 21)
TGATGATTTGAATGAAGATTGATT,
(SEQ ID NO. 23)
TGATAAAGTGATAAAGGATTAAAG,
(SEQ ID NO. 24)
TGATTTGAGTATTTGAGATTTTGA,
(SEQ ID NO. 25)
GTATTTGAGTAAGTAATTGATTGA,
(SEQ ID NO. 28)
GATTGTATTGAAGTATTGTAAAAG,
(SEQ ID NO. 31)
TGATTTGAGATTAAAGAAAGGATT,
(SEQ ID NO. 33)
TGATTGAATTGAGTAAAAAGGATT,
(SEQ ID NO. 34)
AAAGTTGAGATTTGAATGATTGAA,
(SEQ ID NO. 37)
and
GTATTGTATTGAAAAGGTAATTGA,
(SEQ ID NO: 39)
including oligonucleotides complementary thereto.

### Claim 2 (depends on 1)

The oligonucleotide of claim 1, wherein one of the oligonucleotides in SEQ ID NO. 21, 23-25, 28, 31, 33-34, 37, and 39 does not cross-hybridize with a second, different oligonucleotide in SEQ ID NO. 21, 23-25, 28, 31, 33-34, 37, and 39 under the following hybridization conditions: 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C.

### Claim 3 (depends on 1)

The oligonucleotide of claim 1, wherein the oligonucleotide is attached to a solid support.

### Claim 4 (depends on 3)

The oligonucleotide of claim 3, wherein the solid support is a microparticle.

### Claim 5 (depends on 1)

An improved method of analyzing a biological sample suspected of comprising a target, wherein the improvement comprises using the oligonucleotide tag or tag complement of claim 1.

### Claim 6

A nucleic acid tag or tag complement comprising an oligonucleotide selected from the group of oligonucleotides consisting of: SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 37 and SEQ ID NO: 39, or a sequence complementary thereto, wherein the oligonucleotide is attached to a solid support.

### Claim 7 (depends on 6)

The nucleic acid of claim 6, wherein the solid support is a microparticle.

### Claim 8 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 21 or the sequence complementary thereto.

### Claim 9 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 23 or a sequence complementary thereto.

### Claim 10 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 24 or a sequence complementary thereto.

### Claim 11 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 25 or a sequence complementary thereto.

### Claim 12 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 28 or a sequence complementary thereto.

### Claim 13 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 31 or a sequence complementary thereto.

### Claim 14 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 33 or a sequence complementary thereto.

### Claim 15 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 34 or a sequence complementary thereto.

### Claim 16 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO.: 37 or a sequence complementary thereto.

### Claim 17 (depends on 6)

The nucleic acid of claim 6, wherein the oligonucleotide has the sequence set forth in SEQ ID NO: 39 or a sequence complementary thereto.

### Claim 18 (depends on 6)

An improved method of analyzing a biological sample suspected of comprising a target, wherein the improvement comprises using the tag or tag complement of claim 6.

### Claim 19 (depends on 6)

A kit for sorting and identifying polynucleotides, the kit comprising at least one oligonucleotide tag or tag complement of claim 6.

### Claim 20 (depends on 19)

The kit of claim 19, wherein each different oligonucleotide is linked to a defined location on the solid support, the defined location for each said oligonucleotide being different and distinguishable from the defined location for each different oligonucleotide.

### Claim 21 (depends on 20)

The kit of claim 20, wherein the solid support is a microparticle.

### Claim 22 (depends on 21)

The kit of claim 21, wherein each different oligonucleotide is linked to a different microparticle, each microparticle being distinguishable from each other microparticle.

### Claim 23

A combination of oligonucleotide tags or tag complements for use in a multiplexed assay comprising at least one oligonucleotide set forth in SEQ ID NOs.: 21, 23-25, 28, 31, 33-34, 37 or 39 and an oligonucleotide selected from the group consisting of SEQ ID NOs.: 1-210, wherein the combination comprises at least two different oligonucleotides set forth in SEQ ID NOs.: 1-210.

### Claim 24 (depends on 23)

The combination of claim 23, wherein the oligonucleotides are linked to a solid support.

### Claim 25 (depends on 24)

The combination of claim 24, wherein each different oligonucleotide is linked to a defined location on the solid support, the defined location for each said oligonucleotide being different than and distinguishable from the defined location for each different oligonucleotide.

### Claim 26 (depends on 24)

The combination of claim 24, wherein the solid support is a microparticle.

### Claim 27 (depends on 26)

The combination of claim 26, wherein each different oligonucleotide is linked to a different microparticle, each microparticle being distinguishable from each other microparticle.

### Claim 28

A combination comprising a plurality of oligonucleotide tags or tag complements for use in a multiplexed assay, wherein the plurality of tags or tag complements include SEQ ID NOs: 21, 23-25, 28, 31, 33-34, 37 and 39 and sequences complementary thereto.