Method for the screening, the detection and/or the quantification of transcriptional factors

#This application claims priority to European Application Serial Number 00870057.7 filed on Mar. 24, 2000, the disclosure of which is incorporated herein by reference in its entirety.

#The present invention is related to a method and kit comprising reagents and media for the screening, the detection and/or the quantification of transcriptional factors or compounds binding said factors by non radioactive detection means.

#Transcriptional factors are proteins that bind to specific sequences of DNA, called consensus sequences, and influence the transcription of the DNA into mRNA. Some of these factors directly participate in the transcription process by activating or inhibiting the transcription and regulate the synthesis of proteins needed by cells to function, to adapt, to respond or to differentiate. Some of these proteins have to be transcribed in a constitutive manner (essential role in cell functions) while others are only synthesised in response to specific stimuli or when the cells are for instance in pathological environment. External signals are sensed by receptors and transduced through the plasma membrane followed by cascades of enzymatic kinase reactions, resulting in a phosphorylation or dephosphorylation of the transcriptional factors which affects positively or negatively their binding to their consensus sequence.

#FIG. 1 is a schematic presentation of the procedure for an assay or a transcriptional factor according to the invention.

#FIG. 2 represents a DNA-binding assay of 3 different transcription factors (NFκB, CREB and AP-1) measured simultaneously in the same cell extracts in microwells. Microwells contain a 100 bp DNA terminated by the sequence specific for either NFκB, CREB or AP-1, and the DNA binding capacity of the transcriptional is detected respectively with anti-p65, anti phospho-CREB and anti-c-fos (for AP-1 assay) The DNA-binding assay is performed on cell lysates coming either from cells left unstimulated, or stimulated with IL-1, with forskolin, with PMA+ionomycin, with IL-1 and forskolin, with IL-1 and PMA+ionomycin, with forskolin and PMA+ionomycin, and IL-1 and forskolin and PMA+ionomycin. The results show the signal obtained for the assay of NF-KB (A), P-CREB (B) and c-fos (C) on the various cell extracts (NF-KB is strongly induced in IL-1 stimulaued cells, P-CREB by forekolin scimulation and AP-1 by PNA)

#FIG. 3 presents the sensitivity of the DNA-binding assay. DNA-binding activity of purified NFκB (p50) was measured on microwells containing DNA probe specific for NFκB. The concentrations of p50 used in this assay range from 10−12 mole to 5 10−16 mole/well.

#Step 1: Binding of the Double Strand Oligonucleotidic Probe on Multi-well Plates

#The spacer double strand nucleotide sequences were constructed from the following CMV sequence: 5′TGGCCAAGCGGCCTCTGATAACCAAGCCTGAGGTTATCAGTGTAATGAAGCGCCG CATTGAGGAGATCTGCATGAAGGTCTTTGCCCAGTACATTCTGGGGGCCGATCCTCT GAGAGTCTGCTCTCCTAGTGTGGATGACCTACGGGCCATCGCCGAGGAGTCAGATG AGGAAGAGGCTATTGTAGCCTACACTTTGGCCACCGCTGGTGTCAGCTCCTCTGATT CTCTGGTGTCACCCCCAGAGTCCCCTGTAC (SEQ ID NO:146) acting as a spacer was linked to a) the NFκB consensus oligonucleotide 5′AGTTGAGGGGACTTTCCCAGGC-3′ (SEQ ID NO:147) b) the CREB consensus oligonucleotide 5′ATTGCCTGACGTCAGAGAGCTAG-3′ (SEQ ID NO:148) and c) the AP-1 consensus oligonucleotide 5′CCGTTCCGGCTGACTCATCAAGCG-3′ (SEQ ID NO:149). In the example the spacer was of 100 based pairs. The CMV extremity is 5′ biotinylated, so that these probes can be linked to streptavidin-coated 96-wells plates : 2 pmoles of probes per well are incubated 1h at 37° C. in 50 μl 10 mM phosphate buffer 150 mM NaCl (hereafter called PBS150). Plates are then washed and the amount of DNA fixed on streptavidin-coated plates was quantified using the picogreen assay (Molecular Probes, OR, USA). One picomole of DNA was found to be fixed on the wells using DNA standard for calibration of the assay. Step 2: Binding of the Transcription Factor on the Double Strand Probe

#This assay was either performed with purified p50-p50 (Promega, Madison, Wis., USA), or with nuclear cell extracts from SV-40 transformed WI-38 fibroblasts (WI-38 VA13 cell line). Cells were purchased from the ATCC and plated in 75 cm2 flasks. They were serially cultivated in Minimum Essential Medium (Gibco, UK) supplemented with Na2SeO3 10−7 M and antibiotics, in the presence of 10% fetal bovine serum. Cells were stimulated for 30 min with IL-1 (to activate NFκB), forskolin (to activate CREB), PMA+ionomycin (to activate AP-1) or left unstimulated.