Method for rapid generation of mature dendritic cells
AssigneeThe United States of America, as represented by the Secretary, Department of Health and Human Services
InventorsDennis M. Klinman, Mayda Gursel, Daniela Verthelyi
Life of this patent
Estimating the term…
Abstract
Novel methods for rapidly generating dendritic cells are disclosed herein. The methods include contacting a dendritic cell precursor with a D ODN to generate a mature dendritic cell. In one specific, non/limiting example, the method includes contacting the dendritic cell precursor or the mature dendritic cell with an antigen. The methods are of use both in vitro and in vivo.
Claims53
A method for generating a mature dendritic cell, comprising
- contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:
- 5′X1X2X3Pu1Py2CpGPu3Py4X4X5X6(W)M(G)N−3′
- wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X1X2X3 Pu1Py2 and Pu3Py4X4X5X6 are self complementary, thereby generating a mature dendritic cell.
A method for generating a mature dendritic cell, comprising
- contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:
- 5′X1X2X3Pu1Py2CpGPu3Py4X4X5X6(W)M(G)N−3′
- wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X1X2X3 AND X4X5X6 are self complementary, thereby generating a mature dendritic cell.
A method for generating a mature dendritic cell, comprising
- contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising the sequence
- GGTGCATCGATGCAGGGGGG (SEQ ID NO:
- 1);
- or
- GGTGCACCGGTGCAGGGGGG (SEQ ID NO:2).
A method for generating an activated T lymphocyte, comprising:
- contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:
- 5′X1X2X3Pu1Py2CpGPu3Py4X4X5X6(W)M(G)N−3′
- wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X1X2X3 AND X4X5X6 are self complementary, thereby generating a mature antigen presenting dendritic cell;
- and
- contacting the mature antigen presenting dendritic cell with a T lymphocyte in vitro, thereby producing an activated T lymphocyte.
A method of producing an immune response against an antigen in a subject, comprising:
- contacting a dendritic cell precursor with an effective amount of an oligodeoxynucleotide of at least about 16 nucleotides in length comprising a sequence represented by the following formula:
- 5′X1X2X3Pu1Py2CpGPu3Py4X4X5X6(W)M(G)N−3′
- wherein the central CpG motif is unmethylated, Pu is a purine nucleotide, Py is a pyrimidine nucleotide, X and W are any nucleotide, M is any integer from 0 to 10, and N is any integer from 4 to 10, wherein X1X2X3 AND X4X5X6 are self complementary, thereby generating a mature antigen presenting dendritic cell.
Dependencies are inferred from the claim text.