Method to improve translation of polypeptides by using untranslated regions from heat-shock proteins
AssigneeSmithKline Beecham Corporation
InventorsHerve Jean-Clement Coste, Jonathan Henry Ellis
Life of this patent
Estimating the term…
Abstract
Untranslated regions associated with the heat shock response can be used to obtain increased efficiency of translation of polypeptides that are not necessarily normally associated with the heat shock response. This allows the development of greatly improved expression systems. The invention is also useful, for example, in the treatment of a patient suffering from a deficiency in the expression of a polypeptide and in the provision of vaccines.
Claims1
A DNA molecule that can be transcribed to provide an RNA molecule having an untranslated region that provides an increased efficiency of translation of a therapeutic polypeptide in vivo when operably linked to a region encoding said polypeptide;
- wherein said DNA molecule
- (i) does not encode a mammalian Hsp70
- (ii) does not comprise an hsp promoter;
- and
- (iii) comprises
- (a) the sequence:
- 5′ataacggctagcctgaggagctgctgcgacagtccactacctttttc
- gagagtgactcccgttgtcccaaggcttcccagagcgaacctgtgcggct
- gcaggcaccggcgcgtcgagtttccggcgtccggaaggaccgagctcttc
- tcgcggatccagtgttccgtttccagcccccaatctcagagccgagccga
- cagagagcagggaaccgc-3′ (SEQ ID NO:
- 1),
- (b) the complement of the sequence given in (a), or
- (c) a sequence having sequence identity of at least 90% with a sequence as defined in (a) or (b) above.
Dependencies are inferred from the claim text.