G cap-stabilized oligonucleotides
AssigneeSanofi-Aventis Deutschland GmbH
InventorsAnuschirwan Peyman, Eugen Uhlmann
Life of this patent
Estimating the term…
Abstract
Oligonucleotides of the formula 5′-(CAP)-(Oligo)-(CAP)-3′ are disclosed where (oligo) is a nucleotide sequence of from 10 to 40 nucleotides in length, and CAP is Gm, where m is an integer of from zero to ten, the two CAP's which are present in the molecule can be defined independently of each other and must be different in the case where m is zero at the 5′ or 3′ end and the end of the Oligo sequence is other than guanine. The oligonucleotides can be synthesized chemically. The oligonucleotides are used to diagnose or treat cancer, restenosis, a disease caused by a virus, a disease affected by integrins or cell-cell adhesion receptor or a disease triggered by diffusible factors.
Claims32
An oligonucleotide of the formula
- 5′-(CAP)-(Oligo)-(CAP)-3′
- wherein the Oligo is a nucleotide sequence between 10 to 40 nucleotides in length whose 5′ end and 3′ end are Gn, where n is an integer between 0 to 40 and is the number of guanines which occurs at the 5′ or 3′ end of the Oligo,
- wherein each CAP is G(m-n) where m is an integer and is defined independently of each other,
- wherein the a 3′ or 5′ phosphoric diester bridge in each CAP is completely or partially replaced by phosphorothioate bridges, wherein
- (i) m is no greater than ten and may not be zero at both the 5′ and 3′ ends when n is zero at both the 5′ and 3′ ends of the Oligo and,
- (ii) m-n is zero when n is no smaller than ten at either the 5′ or 3′ end of the Oligo, wherein Oligo is
- ACACCCAATTCTGAAAATGG (SEQ ID NO:
- 1).
Dependencies are inferred from the claim text.