α1,3-fucosyltransferase
AssigneeThe Governors of the University of Alberta
InventorsDiane E. Taylor, Zhongming Ge
Life of this patent
Estimating the term…
Abstract
A bacterial α1,3-fucosyltransferase gene and deduced amino acid sequence is provided. The gene is useful for preparing α1,3-fucosyltransferase polypeptide, and active fragment thereof, which can be used in the production of oligosaccharides such as Lewis X, Lewis Y, and siayl Lewis X, which are structurally similar to certain tumor-associated carbohydrate antigens found in mammals. These product glycoconjugates also have research and diagnostic utility in the development of assays to detect mammalian tumors. In addition the polypeptide of the invention can be used to develop diagnostic and research assays to determine the presence of H. pylori in human specimens.
Claims21
An isolated Heliobacter polynucleotide that hybridizes under stringent conditions comprising 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. to a nucleic acid consisting of SEQ ID NO:4 or its complement and wherein the polynucleotide encodes a transmembrane segment-free polypeptide having α1,3-fucosyltransferase activity, or enzymatically active portions thereof.
An isolated polynucleotide encoding any one of the polypeptides as set forth in SEQ ID NOS:1–3 and 7, wherein said polynucleotide comprises a fragment of at least 15 nucleotides in length which will hybridize to SEQ ID NO:4 or its complement under stringent conditions comprising 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C.
A host cell containing the vector of claim 4.
An isolated polynucleotide encoding a fusion construct wherein the isolated polynucleotide comprises:
- (i) a first Helicobacter polynucleotide that hybridizes under stringent conditions comprising 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. to a nucleic acid consisting of SEQ ID NO:4 or its complement and wherein the polynucleotide encodes a transmembrane segment-free polypeptide having α1,3 fucosyltransferase activity, or enzymatically active portions thereof;
- and
- (ii) a second polynucleotide that encodes a selectable marker, wherein the first and second polynucleotides are operably linked.
An isolated polynucleotide encoding a Helicobacter α1,3 fucosyltransferase polypeptide, wherein said polynucleotide is identical to a polynucleotide that is amplified using Helicobacter genomic DNA as a template by PCR using a first primer comprising GGATCCTCTGGCTTGCACAGCTAT (SEQ ID NO:28) and a second primer comprising GAATTCTTATAAGAATGTCTCTCAA (SEQ ID NO:30).
An isolated polynucleotide encoding a fusion construct wherein the isolated polynucleotide comprises:
- (i) a first Helicobacter polynucleotide that is identical to a polynucleotide that is amplified using Helicobacter genomic DNA as template by PCR using a first primer comprising GGATCCTCTGGCTTGCACAGCTAT (SEQ ID NO:28) and a second primer comprising GAATTCTTATAAGAATGTCTCTCAA (SEQ ID NO:30) and wherein the polynucleotide encodes a polypeptide having α1,3 fucosyltransferase activity;
- and
- (ii) a second polynucleotide that encodes a selectable marker, wherein the first and second polynucleotides are operably linked.
Dependencies are inferred from the claim text.