Nucleic acids of the M antigen gene of Histoplasma capsulatum, antigens, vaccines and antibodies, methods and kits for detecting histoplasmas

An isolated nucleic acid consisting of:

• a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific nucleic acid which is 90% similar to a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific nucleic acid which is 90% similar to a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of nucleic acid which is 90% similar to a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• or
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence which is 90% similar to a nucleic acid which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• wherein the nucleic acid does not contain the nucleotide sequences 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:14), 5′TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3′ (SEQ ID NO:15), 5′CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC3′ (SEQ ID NO:16), or nucleotide sequences complementary thereto,
• and wherein the nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60° C. with a nucleotide polymer consisting of a nucleotide sequence of 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:17), 5′CATGCTGAAAGCCTCGACTTCG3′ (SEQ ID NO:18), 5′CAUGCUGAAAGCCUCGACUUCG3′ (SEQ ID NO:19) or 5′CGAAGUCGAGGCUUUCAGCAUG3′ (SEQ ID NO:20).

An isolated nucleic acid consisting of:

• a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific nucleic acid which is 95% similar to a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific nucleic acid which is 95% similar to a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of nucleic acid which is 95% similar to a nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• or
• an H. capsulatum M antigen-specific fragment of a nucleic acid consisting of a nucleotide sequence which is 95% similar to a nucleic acid which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• wherein the nucleic acid does not contain the nucleotide sequences 5′CGAAGTCGAGGCTTTCAGCATG3′(SEQ ID NO:14), 5′TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3′(SEQ ID NO:15), 5′CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC3′ (SEQ ID NO:16), or nucleotide sequences complementary thereto,
• and wherein the nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60° C. with a nucleotide polymer consisting of a nucleotide sequence of 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:17), 5′CATGCTGAAAGCCTCGACTTCG3′ (SEQ ID NO:18), 5′CAUGCUGAAAGCCUCGACUUCG3′ (SEQ ID NO:19) or 5′CGAAGUCGAGGCUUUCAGCAUG3′ (SEQ ID NO:20).

An isolated Histoplasma capsulatum M antigen-specific nucleic acid comprising:

• a nucleic acid having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• or
• a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• wherein the nucleic acid does not contain the nucleotide sequences 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:14), 5′TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3′ (SEQ ID NO:15), 5′CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC3′ (SEQ ID NO:16), or nucleotide sequences complementary thereto,
• and wherein the nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60° C. with a nucleotide polymer consisting of a nucleotide sequence of 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:17), 5′CATGCTGAAAGCCTCGACTTCG3′ (SEQ ID NO:18), 5′CAUGCUGAAAGCCUCGACUUCG3′ (SEQ ID NO:19) or 5′CGAAGUCGAGGCUUUCAGCAUG3′ (SEQ ID NO:20).

An isolated nucleic acid consisting of:

• an H. capsulatum M antigen-specific fragment of a nucleic acid of SEQ ID NO:1;
• or
• an H. capsulatum M antigen-specific fragment of a nucleic acid of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• wherein the nucleic acid does not contain the nucleotide sequences 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:14), 5′TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3′ (SEQ ID NO:15), 5′CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC3′ (SEQ ID NO:16), or nucleotide sequences complementary thereto,
• and wherein the nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60° C. with a nucleotide polymer consisting of a nucleotide sequence of 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:17), 5′CATGCTGAAAGCCTCGACTTCG3′ (SEQ ID NO:18), 5′CAUGCUGAAAGCCUCGACUUCG3′ (SEQ ID NO:19) or 5′CGAAGUCGAGGCUUUCAGCAUG3′ (SEQ ID NO:20).

An isolated Histoplasma capsulatum M antigen-specific nucleic acid selected from the group consisting of:

• a nucleic acid having a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• a nucleic acid having a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• an H. capsulatum M antigen-specific fragment of a nucleic acid, the nucleic acid consisting of a nucleotide sequence as set forth in the Sequence Listing as SEQ ID NO:1;
• and
• an H. capsulatum M antigen-specific fragment of a nucleic acid, the nucleic acid consisting of a nucleotide sequence which is complementary to the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1;
• wherein the nucleic acid does not contain the nucleotide sequences 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:14), 5′TATTAGCTCTAGAATTACCACGGGTATCCAAGTAGTAAGG3′ (SEQ ID NO:15), 5′CCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCC3′ (SEQ ID NO:16), or nucleotide sequences complementary thereto,
• and wherein the nucleic acid is not a nucleic acid consisting essentially of between 10 and 100 nucleotides which is able to form a hybrid at 60° C. with a nucleotide polymer consisting of a nucleotide sequence of 5′CGAAGTCGAGGCTTTCAGCATG3′ (SEQ ID NO:17), 5′CATGCTGAAAGCCTCGACTTCG3′ (SEQ ID NO:18), 5′CAUGCUGAAAGCCUCGACUUCG3′ (SEQ ID NO:19) or 5′CGAAGUCGAGGCUUUCAGCAUG3′ (SEQ ID NO:20).