Oligonucleotides for nucleic acid amplification and for the detection of Mycobacterium tuberculosis

A kit for use in amplifying and detecting Mycobacterium tuberculosis nucleic acid, said kit containing:

• a first oligonucleotide of from 24 to 100 nucleotide bases in length and comprising the nucleotide base sequence of SEQ ID NO:
• 3;
• and
• a second oligonucleotide of from 22 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xGCCGTCACCCCACCAACAAGCT (SEQ ID NO:
• 22) or xGGGATAAGCCTGGGAAACTGGGTCTAATACC (SEQ ID NO:
• 2), wherein x is nothing or is a sequence recognized by an RNA polymerase.

A kit for use in amplifying and detecting Mycrcobacterium tuberculosis nucleic acid, said kit containing:

• a first oligonucleotide of from 23 to 100 nucleotide bases in length and comprising the nucleotide base sequence of SEQ ID NO:
• 8;
• and
• a second oligonucleotide of from 20 to 100 nucleotide bases in length and comprising the nucleotide base sequence of xCCAGGCCACTTCCOCTAACC (SEQ ID NO:
• 23) or xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO:
• 7), wherein x is nothing or is a sequence recognized by an RNA polymerase.

A composition for use in amplifying Mycobacterium tuberculosis nucleic acid, said composition comprising:

• a first primer oligonucleotide consisting of an oligonucleotide up to 100 nucleotide bases in length which hybridizes to a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:23, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said first primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said first region;
• and
• a second primer oligonucleotide consisting of an oligonucleotide up to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 7, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said second primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said second region.

A composition for use in amplifying Mycobacterium tuberculosis nucleic acid, said composition comprising first and second primer oligonucleotides, each of said primer oligonucleotides being up to 100 nucleotide bases in length,

• wherein said first primer oligonucleotide hybridizes to a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, and wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 22, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said first primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said first region, and
• wherein said second primer oligonucleotide hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, and wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 2, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto, and wherein said second primer oligonucleotide includes an at least 10 contiguous nucleotide base sequence which is fully complementary to an at least 10 contiguous nucleotide base sequence contained within said second region.

A probe mix comprising:

• a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable hybridization duplex under reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto;
• and
• a helper oligonucleotide consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NO:
• 9 and SEQ ID NO:
• 10.

A probe mix comprising:

• a hybridization probe of from 10 to 100 nucleotide bases in length which hybridizes with specificity to at least 10 contiguous bases of a nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid to form a detectable hybridization duplex under reaction conditions, wherein the nucleotide base sequence of said region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 3, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto;
• and
• a helper oligonucleotide consisting essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NO:
• 4 and SEQ ID NO:
• 5.

A kit for use in amplifying Mycobacterium tuberculosis nucleic acid, said kit containing:

• a first oligonucleotide comprising the nucleotide base sequence of xCCAGGCCACTTCCGCTAACC (SEQ ID NO:
• 23);
• and
• a second oligonucleotide comprising the nucleotide base sequence of xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO:
• 7),
• wherein x is nothing or is a sequence recognized by an RNA polymerase.

A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:

• a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 3 and SEQ ID NO:
• 8, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto;
• and
• b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 2, SEQ ID NO:
• 7, SEQ ID NO:
• 22 and SEQ ID NO:
• 23, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.

A composition comprising:

• a first oligonucleotide comprising a first primer sequence able to hybridize at or near the 3′ end of a (+) target nucleic acid sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
• a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of said (+) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification, wherein said second oligonucleotide hybridizes to said (+) target sequence in effectively the sane position as said first oligonucleotide, and wherein said modification to said second primer sequence, if present, is different than said modification to said first primer sequence;
• a third oligonucleotide comprising a third primer sequence able to hybridize to the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification;
• an enzyme selected from the group consisting of a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase;
• and
• one or more RNA polymerases that recognize said promoter sequence of said first and second oligonucleotides.

A composition comprising:

• a first oligonucleotide comprising a first primer sequence able to hybridize to the 3′ end of a (+) target nucleic acid sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
• a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification;
• a third oligonucleotide comprising a third primer sequence able to hybridize at or near the 3′ end of said (−) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification, wherein said third oligonucleotide hybridizes to said (−) target sequence in effectively the same position as said second oligonucleotide, and wherein said modification to said third oligonucleotide, if present, is different than said modification to said second oligonucleotide;
• an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase;
• and
• one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.

A kit comprising:

• a first oligonucleotide comprising a first primer sequence able to hybridize at or near the 3′ end of a (+) target nucleic acid sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification;
• a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of said (+) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification, wherein said second oligonucleotide hybridizes to said (+) target sequence in effectively the same position as said first oligonucleotide, and wherein said modification to said second primer sequence, if present, is different than said modification to said first primer sequence;
• a third oligonucleotide comprising a third primer sequence able to hybridize to the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification;
• an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase;
• and
• one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.

A kit comprising:

• a first oligonucleotide comprising a first primer sequence able to hybridize to the 3′ end of a (+) target nucleic acid sequence, an optionally present 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said first primer sequence which reduces or blocks extension of said first primer sequence by a polymerase compared to said first primer sequence not having said modification,
• a second oligonucleotide comprising a second primer sequence able to hybridize at or near the 3′ end of a (−) target nucleic acid sequence which is the complement of said (+) target sequence, a 5′ promoter sequence, and a modification at or near the 3′ end of said second primer sequence which reduces or blocks extension of said second primer sequence by a polymerase compared to said second primer sequence not having said modification;
• a third oligonucleotide comprising a third primer sequence able to hybridize at or near the 3′ end of said (−) target sequence, a 5′ promoter sequence, and an optionally present modification at or near the 3′ end of said third primer sequence which reduces or blocks extension of said third primer sequence by a polymerase compared to said third primer sequence not having said modification, wherein said third oligonucleotide hybridizes to said (−) target sequence in effectively the same position as said second oligonucleotide and said modification to said third oligonucleotide, if present, is different than said modification to said second oligonucleotide;
• an enzyme selected from the group consisting of DNA-dependent DNA polymerase and RNA-dependent DNA polymerase;
• and
• one or more RNA polymerases that recognize said promoter sequences of said first and second oligonucleotides.

A composition comprising:

• a first oligonucleotide having a 3′ end which is not modified to reduce or block extension of said first oligonucleotide by a polymerase;
• and
• a second oligonucleotide having a 3′ end which is modified to reduce or block extension of said second oligonucleotide by a polymerase, wherein each of said first and second oligonucleotides comprises a nucleotide base sequence selected from the group consisting of the nucleotide base sequences of xCCAGGCCACTTCCGCTAACC (SEQ ID NO:
• 23), xCGCGGAACAGGCTAAACCGCACGC (SEQ ID NO:
• 7), and sequences of the same length and fully complementary thereto, wherein x is nothing or a sequence recognized by an RNA polymerase.

A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:

• a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 3, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto;
• and
• b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting the nucleotide base sequences of SEQ ID NO:
• 22 and SEQ ID NO:
• 2, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.

A composition for use in detecting the presence of Mycobacterium tuberculosis in a sample, said composition comprising:

• a) a hybridization probe of from 10 to 100 nucleotide bases in length comprising a nucleotide base sequence which hybridizes with specificity to at least 10 contiguous bases of a first nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under reaction conditions, wherein the nucleotide base sequence of said first region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 8, the RNA equivalent thereof, and sequences of the same length and fully complementary thereto;
• and
• b) a primer oligonucleotide of from 10 to 100 nucleotide bases in length which hybridizes to a second nucleotide base sequence region present in Mycobacterium tuberculosis nucleic acid under amplification reaction conditions, wherein the nucleotide base sequence of said second region is selected from the group consisting of the nucleotide base sequences of SEQ ID NO:
• 23 and SEQ ID NO:
• 7, the RNA equivalents thereof, and sequences of the same length and fully complementary thereto.